Mutagenetix > Incidental Mutation

Incidental Mutation 'R4518:Golga4'

334076

Institutional Source

Beutler Lab

Gene Symbol

Golga4

Ensembl Gene

ENSMUSG00000038708

Gene Name

golgi autoantigen, golgin subfamily a, 4

Synonyms

golgin-245, Olp-1

MMRRC Submission

041762-MU

Accession Numbers

Genbank: NM_018748; MGI: 1859646

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4518 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118506267-118582519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 118559008 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1733 (S1733T)

Ref Sequence

ENSEMBL: ENSMUSP00000081880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]

AlphaFold

Q91VW5

Predicted Effect

probably benign
Transcript: ENSMUST00000084820
AA Change: S1733T

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: S1733T

Domain	Start	End	E-Value	Type
low complexity region	10	41	N/A	INTRINSIC
coiled coil region	157	241	N/A	INTRINSIC
internal_repeat_1	271	299	2.93e-5	PROSPERO
low complexity region	339	351	N/A	INTRINSIC
low complexity region	513	532	N/A	INTRINSIC
low complexity region	547	566	N/A	INTRINSIC
low complexity region	705	715	N/A	INTRINSIC
low complexity region	739	755	N/A	INTRINSIC
low complexity region	882	895	N/A	INTRINSIC
SCOP:d1epua_	940	1076	2e-3	SMART
low complexity region	1138	1152	N/A	INTRINSIC
low complexity region	1161	1182	N/A	INTRINSIC
low complexity region	1204	1228	N/A	INTRINSIC
coiled coil region	1283	1496	N/A	INTRINSIC
internal_repeat_2	1500	1525	5.98e-5	PROSPERO
coiled coil region	1541	1715	N/A	INTRINSIC
low complexity region	1756	1778	N/A	INTRINSIC
internal_repeat_1	1811	1839	2.93e-5	PROSPERO
coiled coil region	1844	1883	N/A	INTRINSIC
internal_repeat_2	1899	1924	5.98e-5	PROSPERO
coiled coil region	1933	2160	N/A	INTRINSIC
Grip	2181	2225	1.38e-16	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000211840
AA Change: S743T

Predicted Effect

probably benign
Transcript: ENSMUST00000212097

Predicted Effect

probably benign
Transcript: ENSMUST00000212183

Predicted Effect

probably benign
Transcript: ENSMUST00000212274

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]

Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110082J24Rik	T	A	5: 30,106,008		probably null	Het
Abr	A	G	11: 76,472,518	S167P	possibly damaging	Het
Adamtsl2	T	C	2: 27,095,547	L481P	probably benign	Het
Atp8b3	C	T	10: 80,523,847	M984I	probably benign	Het
Brip1	G	A	11: 86,077,878	A827V	possibly damaging	Het
Carns1	T	G	19: 4,170,070	T389P	probably benign	Het
Ccdc88a	T	C	11: 29,482,651	I1219T	probably benign	Het
Cckar	T	C	5: 53,699,922	N311S	probably damaging	Het
Cenpc1	A	G	5: 86,047,587	S108P	possibly damaging	Het
Chpf	G	T	1: 75,475,045	S588R	probably damaging	Het
Clca3a2	T	A	3: 144,808,705	T414S	probably damaging	Het
Cntrl	A	G	2: 35,148,974	E1092G	probably damaging	Het
Crb2	C	A	2: 37,790,389	T443K	probably damaging	Het
Cwf19l1	A	G	19: 44,133,034	V25A	probably damaging	Het
Cyb561d1	T	C	3: 108,199,571	I111V	possibly damaging	Het
Dbn1	A	T	13: 55,476,229	I350N	possibly damaging	Het
Dnajb4	T	C	3: 152,185,176	I329V	probably benign	Het
Dnmt1	G	T	9: 20,911,978	D1055E	probably benign	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Fam168a	C	T	7: 100,834,040	A176V	probably damaging	Het
Farp2	A	G	1: 93,620,641	E1016G	probably benign	Het
Fibcd1	A	T	2: 31,817,195	V350E	probably damaging	Het
Galnt3	C	A	2: 66,093,610	R438L	probably damaging	Het
Golgb1	G	A	16: 36,929,263	E3076K	probably damaging	Het
Grm7	A	G	6: 110,914,546		probably null	Het
Hcn2	T	C	10: 79,724,702	V289A	probably benign	Het
Hipk1	G	T	3: 103,750,372	H799N	probably damaging	Het
Ispd	G	A	12: 36,473,180	V203I	possibly damaging	Het
Klf14	A	G	6: 30,957,932	S256P	possibly damaging	Het
Muc6	T	A	7: 141,644,222	T1214S	probably benign	Het
Nlrp2	T	A	7: 5,325,056	D666V	possibly damaging	Het
Ntng1	A	G	3: 109,935,013	I148T	probably damaging	Het
Olfr1277	T	C	2: 111,269,918	M150V	probably benign	Het
Olfr39	A	G	9: 20,286,250	I184V	probably benign	Het
Olfr845	T	A	9: 19,339,260	S267T	possibly damaging	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Pacs2	A	G	12: 113,060,669	D360G	probably benign	Het
Parp8	C	A	13: 116,895,673	L321F	possibly damaging	Het
Pdss2	T	A	10: 43,372,150	S217T	probably damaging	Het
Plekhn1	T	C	4: 156,225,531	S109G	probably damaging	Het
Ppil2	A	T	16: 17,096,041	F173I	possibly damaging	Het
Prlr	C	A	15: 10,328,999	T520K	possibly damaging	Het
Prokr2	T	A	2: 132,374,092		probably null	Het
Rab3gap2	G	A	1: 185,267,068	V991I	probably benign	Het
Reln	T	C	5: 21,901,743	I3210V	probably benign	Het
Rims2	T	C	15: 39,437,526	Y218H	probably damaging	Het
Slc41a1	T	C	1: 131,839,125	V127A	probably damaging	Het
St8sia6	T	A	2: 13,792,751		probably null	Het
Tlr6	A	G	5: 64,954,904	F220S	possibly damaging	Het
Trmt1l	C	T	1: 151,448,343	Q314*	probably null	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Vnn3	G	A	10: 23,867,226	V445M	possibly damaging	Het
Zfhx4	T	C	3: 5,412,518	C3398R	probably damaging	Het
Zfyve16	T	C	13: 92,521,312	E697G	possibly damaging	Het

Other mutations in Golga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00711:Golga4	APN	9	118514271	critical splice donor site	probably null
IGL00801:Golga4	APN	9	118538926	missense	probably damaging	0.98
IGL01395:Golga4	APN	9	118535373	missense	probably damaging	1.00
IGL01472:Golga4	APN	9	118532574	missense	probably damaging	1.00
IGL01519:Golga4	APN	9	118527092	missense	probably damaging	1.00
IGL01563:Golga4	APN	9	118527006	splice site	probably benign
IGL02593:Golga4	APN	9	118555566	unclassified	probably benign
IGL02803:Golga4	APN	9	118535460	missense	probably benign
IGL02939:Golga4	APN	9	118535454	missense	probably benign	0.01
IGL02939:Golga4	APN	9	118534632	missense	probably damaging	1.00
IGL03123:Golga4	APN	9	118536885	missense	probably damaging	1.00
IGL03334:Golga4	APN	9	118537233	splice site	probably benign
F5770:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62
F6893:Golga4	UTSW	9	118553457	missense	probably damaging	1.00
PIT4382001:Golga4	UTSW	9	118553453	missense	possibly damaging	0.88
R0179:Golga4	UTSW	9	118560740	critical splice acceptor site	probably null
R0279:Golga4	UTSW	9	118568993	missense	probably benign	0.00
R0362:Golga4	UTSW	9	118555785	missense	probably benign	0.13
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0974:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R1128:Golga4	UTSW	9	118548784	missense	probably benign	0.40
R1384:Golga4	UTSW	9	118565651	missense	probably damaging	0.99
R1435:Golga4	UTSW	9	118535440	missense	probably benign	0.00
R1513:Golga4	UTSW	9	118555732	missense	probably benign	0.02
R1818:Golga4	UTSW	9	118572987	missense	probably damaging	1.00
R2083:Golga4	UTSW	9	118532590	missense	probably damaging	1.00
R2243:Golga4	UTSW	9	118556904	missense	probably benign	0.06
R2355:Golga4	UTSW	9	118560742	missense	probably benign	0.00
R2518:Golga4	UTSW	9	118556612	missense	probably damaging	1.00
R2921:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2922:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2923:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R3121:Golga4	UTSW	9	118557380	missense	possibly damaging	0.68
R3424:Golga4	UTSW	9	118534647	missense	probably benign	0.16
R3909:Golga4	UTSW	9	118558736	missense	possibly damaging	0.82
R3913:Golga4	UTSW	9	118538971	missense	probably damaging	0.99
R4321:Golga4	UTSW	9	118556435	missense	probably damaging	1.00
R4358:Golga4	UTSW	9	118551878	missense	probably benign	0.16
R4483:Golga4	UTSW	9	118514186	missense	probably damaging	1.00
R4515:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4519:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4545:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4546:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4580:Golga4	UTSW	9	118557259	missense	probably benign	0.00
R4918:Golga4	UTSW	9	118558145	missense	probably damaging	1.00
R5007:Golga4	UTSW	9	118558300	missense	probably benign
R5045:Golga4	UTSW	9	118565656	missense	probably benign
R5232:Golga4	UTSW	9	118506558	critical splice donor site	probably null
R5256:Golga4	UTSW	9	118556501	missense	possibly damaging	0.93
R5502:Golga4	UTSW	9	118559057	nonsense	probably null
R5567:Golga4	UTSW	9	118558183	missense	probably damaging	1.00
R5576:Golga4	UTSW	9	118553534	missense	probably benign	0.13
R5771:Golga4	UTSW	9	118558283	missense	probably damaging	0.96
R5807:Golga4	UTSW	9	118527130	missense	probably damaging	0.99
R5860:Golga4	UTSW	9	118558106	missense	probably damaging	1.00
R6012:Golga4	UTSW	9	118559696	missense	possibly damaging	0.90
R6285:Golga4	UTSW	9	118558627	nonsense	probably null
R6299:Golga4	UTSW	9	118557370	missense	probably benign	0.03
R6467:Golga4	UTSW	9	118536792	missense	probably damaging	1.00
R6552:Golga4	UTSW	9	118514231	missense	probably damaging	1.00
R6688:Golga4	UTSW	9	118514210	missense	possibly damaging	0.66
R6965:Golga4	UTSW	9	118548779	missense	probably damaging	1.00
R6987:Golga4	UTSW	9	118558532	missense	probably benign
R7212:Golga4	UTSW	9	118536840	missense	possibly damaging	0.80
R7426:Golga4	UTSW	9	118559495	missense	probably benign
R7431:Golga4	UTSW	9	118559731	missense	probably damaging	1.00
R7641:Golga4	UTSW	9	118557575	missense	probably benign	0.05
R7727:Golga4	UTSW	9	118548702	missense	probably damaging	1.00
R7729:Golga4	UTSW	9	118556063	missense	possibly damaging	0.51
R7811:Golga4	UTSW	9	118532575	missense	probably damaging	1.00
R7849:Golga4	UTSW	9	118559311	missense	possibly damaging	0.93
R7891:Golga4	UTSW	9	118556366	missense	probably damaging	1.00
R7976:Golga4	UTSW	9	118536768	missense	possibly damaging	0.49
R8275:Golga4	UTSW	9	118532559	missense	probably damaging	1.00
R8378:Golga4	UTSW	9	118558322	missense	probably benign	0.03
R8514:Golga4	UTSW	9	118555796	missense	possibly damaging	0.47
R8698:Golga4	UTSW	9	118555961	missense	probably damaging	0.97
R8856:Golga4	UTSW	9	118556711	missense	probably damaging	0.98
R9227:Golga4	UTSW	9	118556873	missense	possibly damaging	0.94
R9282:Golga4	UTSW	9	118556825	missense	probably damaging	1.00
RF022:Golga4	UTSW	9	118557989	missense	probably damaging	1.00
V7583:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- GGAAGCAGCTCTTGTCTCAG -3'
(R):5'- CCTGGCTCTAGTGCAGTCTAAC -3'

Sequencing Primer
(F):5'- CAGCTCTTGTCTCAGATGGAAGAG -3'
(R):5'- GTGCAGTCTAACTTTCCAGAGAGC -3'

Posted On

2015-08-18