Incidental Mutation 'R4518:Pdss2'
ID334078
Institutional Source Beutler Lab
Gene Symbol Pdss2
Ensembl Gene ENSMUSG00000038240
Gene Nameprenyl (solanesyl) diphosphate synthase, subunit 2
Synonyms5430420P03Rik, kd, mDLP1, PLMP
MMRRC Submission 041762-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4518 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location43221486-43464882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43372150 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 217 (S217T)
Ref Sequence ENSEMBL: ENSMUSP00000124864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095725] [ENSMUST00000159139] [ENSMUST00000160823]
Predicted Effect probably damaging
Transcript: ENSMUST00000095725
AA Change: S217T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093393
Gene: ENSMUSG00000038240
AA Change: S217T

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
Pfam:polyprenyl_synt 106 324 9e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159139
AA Change: S217T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124864
Gene: ENSMUSG00000038240
AA Change: S217T

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
Pfam:polyprenyl_synt 103 323 7.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160308
Predicted Effect possibly damaging
Transcript: ENSMUST00000160823
AA Change: S217T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124046
Gene: ENSMUSG00000038240
AA Change: S217T

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
Pfam:polyprenyl_synt 103 319 7.4e-15 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that synthesizes the prenyl side-chain of coenzyme Q, or ubiquinone, one of the key elements in the respiratory chain. The gene product catalyzes the formation of all trans-polyprenyl pyrophosphates from isopentyl diphosphate in the assembly of polyisoprenoid side chains, the first step in coenzyme Q biosynthesis. Defects in this gene are a cause of coenzyme Q10 deficiency.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mutations in this gene result in renal abnormalities leading to early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,106,008 probably null Het
Abr A G 11: 76,472,518 S167P possibly damaging Het
Adamtsl2 T C 2: 27,095,547 L481P probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Brip1 G A 11: 86,077,878 A827V possibly damaging Het
Carns1 T G 19: 4,170,070 T389P probably benign Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cckar T C 5: 53,699,922 N311S probably damaging Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Chpf G T 1: 75,475,045 S588R probably damaging Het
Clca3a2 T A 3: 144,808,705 T414S probably damaging Het
Cntrl A G 2: 35,148,974 E1092G probably damaging Het
Crb2 C A 2: 37,790,389 T443K probably damaging Het
Cwf19l1 A G 19: 44,133,034 V25A probably damaging Het
Cyb561d1 T C 3: 108,199,571 I111V possibly damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnajb4 T C 3: 152,185,176 I329V probably benign Het
Dnmt1 G T 9: 20,911,978 D1055E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam168a C T 7: 100,834,040 A176V probably damaging Het
Farp2 A G 1: 93,620,641 E1016G probably benign Het
Fibcd1 A T 2: 31,817,195 V350E probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Golgb1 G A 16: 36,929,263 E3076K probably damaging Het
Grm7 A G 6: 110,914,546 probably null Het
Hcn2 T C 10: 79,724,702 V289A probably benign Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Ispd G A 12: 36,473,180 V203I possibly damaging Het
Klf14 A G 6: 30,957,932 S256P possibly damaging Het
Muc6 T A 7: 141,644,222 T1214S probably benign Het
Nlrp2 T A 7: 5,325,056 D666V possibly damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Olfr1277 T C 2: 111,269,918 M150V probably benign Het
Olfr39 A G 9: 20,286,250 I184V probably benign Het
Olfr845 T A 9: 19,339,260 S267T possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pacs2 A G 12: 113,060,669 D360G probably benign Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Ppil2 A T 16: 17,096,041 F173I possibly damaging Het
Prlr C A 15: 10,328,999 T520K possibly damaging Het
Prokr2 T A 2: 132,374,092 probably null Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Reln T C 5: 21,901,743 I3210V probably benign Het
Rims2 T C 15: 39,437,526 Y218H probably damaging Het
Slc41a1 T C 1: 131,839,125 V127A probably damaging Het
St8sia6 T A 2: 13,792,751 probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Trmt1l C T 1: 151,448,343 Q314* probably null Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vnn3 G A 10: 23,867,226 V445M possibly damaging Het
Zfhx4 T C 3: 5,412,518 C3398R probably damaging Het
Zfyve16 T C 13: 92,521,312 E697G possibly damaging Het
Other mutations in Pdss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02346:Pdss2 APN 10 43345643 missense possibly damaging 0.80
IGL03337:Pdss2 APN 10 43345593 missense probably damaging 1.00
IGL03340:Pdss2 APN 10 43394001 missense probably benign 0.00
R0277:Pdss2 UTSW 10 43372176 missense probably benign
R0323:Pdss2 UTSW 10 43372176 missense probably benign
R0324:Pdss2 UTSW 10 43393928 missense probably damaging 1.00
R0508:Pdss2 UTSW 10 43221931 small deletion probably benign
R0654:Pdss2 UTSW 10 43221931 small deletion probably benign
R1472:Pdss2 UTSW 10 43413537 missense probably benign 0.00
R1801:Pdss2 UTSW 10 43345605 missense probably benign 0.29
R2024:Pdss2 UTSW 10 43393875 missense possibly damaging 0.81
R2025:Pdss2 UTSW 10 43393875 missense possibly damaging 0.81
R2026:Pdss2 UTSW 10 43393875 missense possibly damaging 0.81
R4077:Pdss2 UTSW 10 43402522 missense probably benign
R4079:Pdss2 UTSW 10 43402522 missense probably benign
R4292:Pdss2 UTSW 10 43221838 missense probably benign
R4603:Pdss2 UTSW 10 43372201 missense probably damaging 0.99
R4962:Pdss2 UTSW 10 43298912 missense possibly damaging 0.47
R5016:Pdss2 UTSW 10 43222005 missense probably damaging 1.00
R5610:Pdss2 UTSW 10 43439832 missense probably benign 0.00
R5888:Pdss2 UTSW 10 43221797 synonymous silent
R5972:Pdss2 UTSW 10 43298926 missense probably damaging 0.99
R7246:Pdss2 UTSW 10 43372176 missense probably benign
R7697:Pdss2 UTSW 10 43345548 missense probably damaging 1.00
R7765:Pdss2 UTSW 10 43464632 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GGAGTCCTGGAAAAGTAGCCAC -3'
(R):5'- GCCATGAATTTGTAGCCAAAAC -3'

Sequencing Primer
(F):5'- GAGTCCTGGAAAAGTAGCCACTTAAC -3'
(R):5'- ATGAATTTGTAGCCAAAACACTAATC -3'
Posted On2015-08-18