Incidental Mutation 'R4518:Brip1'
ID334084
Institutional Source Beutler Lab
Gene Symbol Brip1
Ensembl Gene ENSMUSG00000034329
Gene NameBRCA1 interacting protein C-terminal helicase 1
Synonyms8030460J03Rik, 3110009N10Rik, BACH1
MMRRC Submission 041762-MU
Accession Numbers

Ncbi RefSeq: NM_178309.2; MGI:2442836

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4518 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86058138-86201193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86077878 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 827 (A827V)
Ref Sequence ENSEMBL: ENSMUSP00000043108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044423]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044423
AA Change: A827V

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043108
Gene: ENSMUSG00000034329
AA Change: A827V

DomainStartEndE-ValueType
DEXDc 17 520 1.4e-3 SMART
HELICc 701 854 8.2e-41 SMART
Meta Mutation Damage Score 0.5108 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: This gene encodes a member of the DEAH subfamily of DEAD box helicases. A similar protein in humans is both a DNA-dependent ATPase and a 5-prime-to-3-prime DNA helicase, and plays a role in the repair of DNA double stranded breaks through interaction with the breast cancer-associated tumor suppressor BRCA1. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit gonadal atrophy, subfertility, germ cell attrition, epithelial tumor predisposition, increased cellular sensitivity to interstrand crosslink-inducing agents, hypersensitivity to replication inhibitors, and predisposition to lymphoma. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,106,008 probably null Het
Abr A G 11: 76,472,518 S167P possibly damaging Het
Adamtsl2 T C 2: 27,095,547 L481P probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Carns1 T G 19: 4,170,070 T389P probably benign Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cckar T C 5: 53,699,922 N311S probably damaging Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Chpf G T 1: 75,475,045 S588R probably damaging Het
Clca3a2 T A 3: 144,808,705 T414S probably damaging Het
Cntrl A G 2: 35,148,974 E1092G probably damaging Het
Crb2 C A 2: 37,790,389 T443K probably damaging Het
Cwf19l1 A G 19: 44,133,034 V25A probably damaging Het
Cyb561d1 T C 3: 108,199,571 I111V possibly damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnajb4 T C 3: 152,185,176 I329V probably benign Het
Dnmt1 G T 9: 20,911,978 D1055E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam168a C T 7: 100,834,040 A176V probably damaging Het
Farp2 A G 1: 93,620,641 E1016G probably benign Het
Fibcd1 A T 2: 31,817,195 V350E probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Golgb1 G A 16: 36,929,263 E3076K probably damaging Het
Grm7 A G 6: 110,914,546 probably null Het
Hcn2 T C 10: 79,724,702 V289A probably benign Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Ispd G A 12: 36,473,180 V203I possibly damaging Het
Klf14 A G 6: 30,957,932 S256P possibly damaging Het
Muc6 T A 7: 141,644,222 T1214S probably benign Het
Nlrp2 T A 7: 5,325,056 D666V possibly damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Olfr1277 T C 2: 111,269,918 M150V probably benign Het
Olfr39 A G 9: 20,286,250 I184V probably benign Het
Olfr845 T A 9: 19,339,260 S267T possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pacs2 A G 12: 113,060,669 D360G probably benign Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Pdss2 T A 10: 43,372,150 S217T probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Ppil2 A T 16: 17,096,041 F173I possibly damaging Het
Prlr C A 15: 10,328,999 T520K possibly damaging Het
Prokr2 T A 2: 132,374,092 probably null Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Reln T C 5: 21,901,743 I3210V probably benign Het
Rims2 T C 15: 39,437,526 Y218H probably damaging Het
Slc41a1 T C 1: 131,839,125 V127A probably damaging Het
St8sia6 T A 2: 13,792,751 probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Trmt1l C T 1: 151,448,343 Q314* probably null Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vnn3 G A 10: 23,867,226 V445M possibly damaging Het
Zfhx4 T C 3: 5,412,518 C3398R probably damaging Het
Zfyve16 T C 13: 92,521,312 E697G possibly damaging Het
Other mutations in Brip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Brip1 APN 11 86148401 missense possibly damaging 0.53
IGL01098:Brip1 APN 11 86108862 missense possibly damaging 0.71
IGL01503:Brip1 APN 11 86061877 missense probably benign 0.33
IGL01602:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01605:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01940:Brip1 APN 11 86064966 missense probably benign 0.00
IGL02019:Brip1 APN 11 86197949 missense possibly damaging 0.73
IGL02212:Brip1 APN 11 86139015 missense possibly damaging 0.86
IGL02456:Brip1 APN 11 86065099 missense possibly damaging 0.71
IGL02727:Brip1 APN 11 86152736 missense probably benign 0.02
IGL02983:Brip1 APN 11 86139124 missense probably benign 0.03
IGL03022:Brip1 APN 11 86077950 missense probably damaging 0.98
IGL03116:Brip1 APN 11 86064909 nonsense probably null
IGL03143:Brip1 APN 11 86061827 missense possibly damaging 0.53
P0018:Brip1 UTSW 11 86108868 missense possibly damaging 0.51
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0446:Brip1 UTSW 11 86157601 missense probably damaging 0.98
R0498:Brip1 UTSW 11 86197919 missense possibly damaging 0.96
R0599:Brip1 UTSW 11 86152737 missense probably benign
R0653:Brip1 UTSW 11 86152658 missense possibly damaging 0.85
R0661:Brip1 UTSW 11 86110363 missense possibly damaging 0.86
R0671:Brip1 UTSW 11 86152667 missense possibly damaging 0.93
R0718:Brip1 UTSW 11 86143305 missense possibly damaging 0.96
R0750:Brip1 UTSW 11 86061499 missense possibly damaging 0.53
R0834:Brip1 UTSW 11 86192827 missense probably benign
R1128:Brip1 UTSW 11 86064937 missense possibly damaging 0.86
R1726:Brip1 UTSW 11 86064914 missense probably benign 0.17
R1813:Brip1 UTSW 11 86187080 missense possibly damaging 0.53
R1885:Brip1 UTSW 11 86138815 missense probably damaging 1.00
R1886:Brip1 UTSW 11 86138815 missense probably damaging 1.00
R2093:Brip1 UTSW 11 86139145 missense possibly damaging 0.53
R2206:Brip1 UTSW 11 86061877 missense probably benign 0.33
R2207:Brip1 UTSW 11 86061877 missense probably benign 0.33
R3404:Brip1 UTSW 11 86143263 missense possibly damaging 0.96
R3421:Brip1 UTSW 11 86152669 nonsense probably null
R3876:Brip1 UTSW 11 86152790 missense probably damaging 0.98
R4018:Brip1 UTSW 11 86138851 missense possibly damaging 0.86
R4092:Brip1 UTSW 11 86148521 missense possibly damaging 0.92
R4384:Brip1 UTSW 11 86148429 missense possibly damaging 0.70
R4394:Brip1 UTSW 11 86074298 missense possibly damaging 0.85
R4522:Brip1 UTSW 11 86189801 missense possibly damaging 0.49
R4840:Brip1 UTSW 11 86146183 missense possibly damaging 0.86
R5025:Brip1 UTSW 11 86064980 missense probably benign 0.04
R5176:Brip1 UTSW 11 86077884 missense probably damaging 0.98
R5213:Brip1 UTSW 11 86143321 missense possibly damaging 0.73
R5470:Brip1 UTSW 11 86148542 missense possibly damaging 0.71
R5525:Brip1 UTSW 11 86110447 missense possibly damaging 0.85
R6057:Brip1 UTSW 11 86065039 missense possibly damaging 0.73
R6819:Brip1 UTSW 11 86110441 missense possibly damaging 0.51
R6908:Brip1 UTSW 11 86077884 missense probably damaging 0.98
R6920:Brip1 UTSW 11 86148536 nonsense probably null
R7053:Brip1 UTSW 11 86192965 missense possibly damaging 0.53
R7235:Brip1 UTSW 11 86138875 missense possibly damaging 0.53
R7253:Brip1 UTSW 11 86143278 missense possibly damaging 0.96
R7347:Brip1 UTSW 11 86139103 missense probably benign 0.34
R7476:Brip1 UTSW 11 86157808 missense probably benign 0.33
R7580:Brip1 UTSW 11 86157601 missense probably damaging 0.98
R7771:Brip1 UTSW 11 86062024 missense probably benign 0.02
X0060:Brip1 UTSW 11 86152619 missense possibly damaging 0.71
X0062:Brip1 UTSW 11 86143356 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GATGTCTCAGTTGGCAAAGTG -3'
(R):5'- GCTGAAACACTCACACGTGC -3'

Sequencing Primer
(F):5'- GTGCTTGCCACAGTTTTCAAC -3'
(R):5'- CGTGCAAAACAAGATACCCTAAATC -3'
Posted On2015-08-18