Incidental Mutation 'R4518:Ispd'
ID334085
Institutional Source Beutler Lab
Gene Symbol Ispd
Ensembl Gene ENSMUSG00000043153
Gene Nameisoprenoid synthase domain containing
Synonyms
MMRRC Submission 041762-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4518 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location36381450-36689503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36473180 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 203 (V203I)
Ref Sequence ENSEMBL: ENSMUSP00000152872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062041] [ENSMUST00000220519] [ENSMUST00000221177] [ENSMUST00000221452] [ENSMUST00000221895] [ENSMUST00000223068] [ENSMUST00000223205]
Predicted Effect probably benign
Transcript: ENSMUST00000062041
AA Change: V253I

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000061646
Gene: ENSMUSG00000043153
AA Change: V253I

DomainStartEndE-ValueType
Pfam:IspD 45 277 2.5e-40 PFAM
Pfam:NTP_transf_3 47 274 3.1e-11 PFAM
low complexity region 359 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220519
AA Change: V253I

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000221177
AA Change: V154I

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000221452
AA Change: V253I

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000221895
AA Change: V253I

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000223068
AA Change: V154I

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223205
AA Change: V203I

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.2591 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase-like protein. Mutations in this gene are the cause of Walker-Warburg syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit neonatal lethality due to respiratory failure, abnormal axon guidance and fasciculation, abnormal dorsal funiculus, detachment of radial glial cell endfeet and neuronal heterotopias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,106,008 probably null Het
Abr A G 11: 76,472,518 S167P possibly damaging Het
Adamtsl2 T C 2: 27,095,547 L481P probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Brip1 G A 11: 86,077,878 A827V possibly damaging Het
Carns1 T G 19: 4,170,070 T389P probably benign Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cckar T C 5: 53,699,922 N311S probably damaging Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Chpf G T 1: 75,475,045 S588R probably damaging Het
Clca3a2 T A 3: 144,808,705 T414S probably damaging Het
Cntrl A G 2: 35,148,974 E1092G probably damaging Het
Crb2 C A 2: 37,790,389 T443K probably damaging Het
Cwf19l1 A G 19: 44,133,034 V25A probably damaging Het
Cyb561d1 T C 3: 108,199,571 I111V possibly damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnajb4 T C 3: 152,185,176 I329V probably benign Het
Dnmt1 G T 9: 20,911,978 D1055E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam168a C T 7: 100,834,040 A176V probably damaging Het
Farp2 A G 1: 93,620,641 E1016G probably benign Het
Fibcd1 A T 2: 31,817,195 V350E probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Golgb1 G A 16: 36,929,263 E3076K probably damaging Het
Grm7 A G 6: 110,914,546 probably null Het
Hcn2 T C 10: 79,724,702 V289A probably benign Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Klf14 A G 6: 30,957,932 S256P possibly damaging Het
Muc6 T A 7: 141,644,222 T1214S probably benign Het
Nlrp2 T A 7: 5,325,056 D666V possibly damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Olfr1277 T C 2: 111,269,918 M150V probably benign Het
Olfr39 A G 9: 20,286,250 I184V probably benign Het
Olfr845 T A 9: 19,339,260 S267T possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pacs2 A G 12: 113,060,669 D360G probably benign Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Pdss2 T A 10: 43,372,150 S217T probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Ppil2 A T 16: 17,096,041 F173I possibly damaging Het
Prlr C A 15: 10,328,999 T520K possibly damaging Het
Prokr2 T A 2: 132,374,092 probably null Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Reln T C 5: 21,901,743 I3210V probably benign Het
Rims2 T C 15: 39,437,526 Y218H probably damaging Het
Slc41a1 T C 1: 131,839,125 V127A probably damaging Het
St8sia6 T A 2: 13,792,751 probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Trmt1l C T 1: 151,448,343 Q314* probably null Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vnn3 G A 10: 23,867,226 V445M possibly damaging Het
Zfhx4 T C 3: 5,412,518 C3398R probably damaging Het
Zfyve16 T C 13: 92,521,312 E697G possibly damaging Het
Other mutations in Ispd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Ispd APN 12 36473177 missense probably damaging 1.00
IGL01845:Ispd APN 12 36547919 missense probably benign 0.10
R0329:Ispd UTSW 12 36381838 missense possibly damaging 0.71
R0513:Ispd UTSW 12 36390468 missense probably damaging 1.00
R0798:Ispd UTSW 12 36521999 missense probably benign 0.26
R1676:Ispd UTSW 12 36476721 missense probably benign 0.02
R1704:Ispd UTSW 12 36521494 missense probably benign 0.00
R1937:Ispd UTSW 12 36390368 missense probably benign 0.13
R1987:Ispd UTSW 12 36521996 missense probably damaging 1.00
R5726:Ispd UTSW 12 36547830 missense probably damaging 0.99
R6508:Ispd UTSW 12 36426299 missense possibly damaging 0.92
R7315:Ispd UTSW 12 36390374 missense probably benign 0.00
R7395:Ispd UTSW 12 36501995 missense possibly damaging 0.86
R7819:Ispd UTSW 12 36381903 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTTGCTCATTCTCGGACTG -3'
(R):5'- CTGTACCCTTGCACACAGTG -3'

Sequencing Primer
(F):5'- GCTCATTCTCGGACTGATTCC -3'
(R):5'- GCACACAGTGGGTATTTTTGAAC -3'
Posted On2015-08-18