Incidental Mutation 'R4518:Zfyve16'
ID334088
Institutional Source Beutler Lab
Gene Symbol Zfyve16
Ensembl Gene ENSMUSG00000021706
Gene Namezinc finger, FYVE domain containing 16
SynonymsB130024H06Rik
MMRRC Submission 041762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R4518 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location92487108-92530868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92521312 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 697 (E697G)
Ref Sequence ENSEMBL: ENSMUSP00000022217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022217]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022217
AA Change: E697G

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022217
Gene: ENSMUSG00000021706
AA Change: E697G

DomainStartEndE-ValueType
low complexity region 163 175 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
low complexity region 455 484 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
FYVE 727 794 7.25e-31 SMART
low complexity region 821 838 N/A INTRINSIC
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1050 1063 N/A INTRINSIC
Pfam:DUF3480 1155 1503 3.3e-169 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156586
Meta Mutation Damage Score 0.0615 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endosomal protein that belongs to the FYVE zinc finger family of proteins. The encoded protein is thought to regulate membrane trafficking in the endosome. This protein functions as a scaffold protein in the transforming growth factor-beta signaling pathway and is involved in positive and negative feedback regulation of the bone morphogenetic protein signaling pathway. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,106,008 probably null Het
Abr A G 11: 76,472,518 S167P possibly damaging Het
Adamtsl2 T C 2: 27,095,547 L481P probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Brip1 G A 11: 86,077,878 A827V possibly damaging Het
Carns1 T G 19: 4,170,070 T389P probably benign Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cckar T C 5: 53,699,922 N311S probably damaging Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Chpf G T 1: 75,475,045 S588R probably damaging Het
Clca3a2 T A 3: 144,808,705 T414S probably damaging Het
Cntrl A G 2: 35,148,974 E1092G probably damaging Het
Crb2 C A 2: 37,790,389 T443K probably damaging Het
Cwf19l1 A G 19: 44,133,034 V25A probably damaging Het
Cyb561d1 T C 3: 108,199,571 I111V possibly damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnajb4 T C 3: 152,185,176 I329V probably benign Het
Dnmt1 G T 9: 20,911,978 D1055E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam168a C T 7: 100,834,040 A176V probably damaging Het
Farp2 A G 1: 93,620,641 E1016G probably benign Het
Fibcd1 A T 2: 31,817,195 V350E probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Golgb1 G A 16: 36,929,263 E3076K probably damaging Het
Grm7 A G 6: 110,914,546 probably null Het
Hcn2 T C 10: 79,724,702 V289A probably benign Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Ispd G A 12: 36,473,180 V203I possibly damaging Het
Klf14 A G 6: 30,957,932 S256P possibly damaging Het
Muc6 T A 7: 141,644,222 T1214S probably benign Het
Nlrp2 T A 7: 5,325,056 D666V possibly damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Olfr1277 T C 2: 111,269,918 M150V probably benign Het
Olfr39 A G 9: 20,286,250 I184V probably benign Het
Olfr845 T A 9: 19,339,260 S267T possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pacs2 A G 12: 113,060,669 D360G probably benign Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Pdss2 T A 10: 43,372,150 S217T probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Ppil2 A T 16: 17,096,041 F173I possibly damaging Het
Prlr C A 15: 10,328,999 T520K possibly damaging Het
Prokr2 T A 2: 132,374,092 probably null Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Reln T C 5: 21,901,743 I3210V probably benign Het
Rims2 T C 15: 39,437,526 Y218H probably damaging Het
Slc41a1 T C 1: 131,839,125 V127A probably damaging Het
St8sia6 T A 2: 13,792,751 probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Trmt1l C T 1: 151,448,343 Q314* probably null Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vnn3 G A 10: 23,867,226 V445M possibly damaging Het
Zfhx4 T C 3: 5,412,518 C3398R probably damaging Het
Other mutations in Zfyve16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Zfyve16 APN 13 92516538 missense possibly damaging 0.56
IGL00737:Zfyve16 APN 13 92521118 nonsense probably null
IGL00741:Zfyve16 APN 13 92524253 missense probably damaging 1.00
IGL00753:Zfyve16 APN 13 92521118 nonsense probably null
IGL01123:Zfyve16 APN 13 92492522 missense probably damaging 1.00
IGL01149:Zfyve16 APN 13 92508283 missense probably damaging 1.00
IGL01414:Zfyve16 APN 13 92522196 missense probably benign 0.04
IGL01771:Zfyve16 APN 13 92522172 missense probably benign 0.38
IGL01889:Zfyve16 APN 13 92522569 missense possibly damaging 0.87
IGL01928:Zfyve16 APN 13 92504498 missense probably damaging 0.97
IGL02524:Zfyve16 APN 13 92504514 missense probably benign 0.19
IGL03102:Zfyve16 APN 13 92511817 missense possibly damaging 0.57
IGL03192:Zfyve16 APN 13 92521240 missense possibly damaging 0.94
PIT4151001:Zfyve16 UTSW 13 92521204 missense probably damaging 0.99
R0321:Zfyve16 UTSW 13 92492534 missense probably damaging 0.99
R0548:Zfyve16 UTSW 13 92494944 missense probably benign 0.00
R0555:Zfyve16 UTSW 13 92516520 splice site probably benign
R0616:Zfyve16 UTSW 13 92521129 missense probably damaging 1.00
R0727:Zfyve16 UTSW 13 92493878 missense possibly damaging 0.81
R0730:Zfyve16 UTSW 13 92521477 missense probably damaging 0.98
R1221:Zfyve16 UTSW 13 92508305 missense possibly damaging 0.87
R1297:Zfyve16 UTSW 13 92522332 missense probably benign 0.41
R1597:Zfyve16 UTSW 13 92508247 missense probably benign 0.02
R1635:Zfyve16 UTSW 13 92509020 missense probably damaging 1.00
R1803:Zfyve16 UTSW 13 92504085 missense probably damaging 1.00
R1840:Zfyve16 UTSW 13 92511525 missense possibly damaging 0.79
R1962:Zfyve16 UTSW 13 92522744 missense possibly damaging 0.74
R2029:Zfyve16 UTSW 13 92504477 missense probably damaging 0.98
R2083:Zfyve16 UTSW 13 92524262 missense probably damaging 1.00
R2122:Zfyve16 UTSW 13 92519483 nonsense probably null
R2173:Zfyve16 UTSW 13 92495088 missense probably damaging 0.99
R3822:Zfyve16 UTSW 13 92521261 missense probably damaging 1.00
R3857:Zfyve16 UTSW 13 92494971 missense probably damaging 1.00
R4043:Zfyve16 UTSW 13 92513763 intron probably null
R4056:Zfyve16 UTSW 13 92504549 missense probably damaging 1.00
R4495:Zfyve16 UTSW 13 92488567 missense probably benign 0.25
R4835:Zfyve16 UTSW 13 92522185 missense probably benign 0.18
R4862:Zfyve16 UTSW 13 92508256 missense probably damaging 1.00
R4962:Zfyve16 UTSW 13 92513894 missense probably damaging 1.00
R5117:Zfyve16 UTSW 13 92505689 missense possibly damaging 0.95
R5344:Zfyve16 UTSW 13 92521588 missense possibly damaging 0.79
R5358:Zfyve16 UTSW 13 92508263 missense probably benign 0.04
R5407:Zfyve16 UTSW 13 92500284 missense probably damaging 1.00
R5410:Zfyve16 UTSW 13 92521231 missense probably benign 0.08
R5704:Zfyve16 UTSW 13 92504471 splice site probably null
R5731:Zfyve16 UTSW 13 92508193 missense probably benign 0.11
R5808:Zfyve16 UTSW 13 92495055 nonsense probably null
R5828:Zfyve16 UTSW 13 92513902 missense probably damaging 1.00
R5928:Zfyve16 UTSW 13 92522117 missense probably benign 0.01
R6044:Zfyve16 UTSW 13 92522666 nonsense probably null
R6141:Zfyve16 UTSW 13 92511597 missense probably benign 0.00
R6538:Zfyve16 UTSW 13 92504516 missense probably damaging 1.00
R6594:Zfyve16 UTSW 13 92513818 missense probably benign 0.23
R6767:Zfyve16 UTSW 13 92508199 missense probably damaging 1.00
R6942:Zfyve16 UTSW 13 92516631 missense probably benign
R7011:Zfyve16 UTSW 13 92521987 missense probably benign 0.00
R7381:Zfyve16 UTSW 13 92521146 missense probably damaging 1.00
R7531:Zfyve16 UTSW 13 92522965 missense probably damaging 1.00
R7617:Zfyve16 UTSW 13 92504562 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCCCAGGACCATGGAAG -3'
(R):5'- AAGGGATGAATTGCCAGTCCC -3'

Sequencing Primer
(F):5'- TTCCCACATGCTCGGCAG -3'
(R):5'- CCAGTATTAAAACCCAAGCTGTTG -3'
Posted On2015-08-18