Incidental Mutation 'R4518:Parp8'
ID334089
Institutional Source Beutler Lab
Gene Symbol Parp8
Ensembl Gene ENSMUSG00000021725
Gene Namepoly (ADP-ribose) polymerase family, member 8
SynonymsD13Ertd275e, 2810430O08Rik
MMRRC Submission 041762-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4518 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location116854820-117025537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 116895673 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 321 (L321F)
Ref Sequence ENSEMBL: ENSMUSP00000022239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022239] [ENSMUST00000223949] [ENSMUST00000225344] [ENSMUST00000226107]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022239
AA Change: L321F

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022239
Gene: ENSMUSG00000021725
AA Change: L321F

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
internal_repeat_1 332 410 4.61e-10 PROSPERO
internal_repeat_1 404 476 4.61e-10 PROSPERO
low complexity region 497 514 N/A INTRINSIC
Pfam:PARP 712 839 2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223949
AA Change: L282F

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000225344
Predicted Effect probably benign
Transcript: ENSMUST00000226107
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,106,008 probably null Het
Abr A G 11: 76,472,518 S167P possibly damaging Het
Adamtsl2 T C 2: 27,095,547 L481P probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Brip1 G A 11: 86,077,878 A827V possibly damaging Het
Carns1 T G 19: 4,170,070 T389P probably benign Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cckar T C 5: 53,699,922 N311S probably damaging Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Chpf G T 1: 75,475,045 S588R probably damaging Het
Clca3a2 T A 3: 144,808,705 T414S probably damaging Het
Cntrl A G 2: 35,148,974 E1092G probably damaging Het
Crb2 C A 2: 37,790,389 T443K probably damaging Het
Cwf19l1 A G 19: 44,133,034 V25A probably damaging Het
Cyb561d1 T C 3: 108,199,571 I111V possibly damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnajb4 T C 3: 152,185,176 I329V probably benign Het
Dnmt1 G T 9: 20,911,978 D1055E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam168a C T 7: 100,834,040 A176V probably damaging Het
Farp2 A G 1: 93,620,641 E1016G probably benign Het
Fibcd1 A T 2: 31,817,195 V350E probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Golgb1 G A 16: 36,929,263 E3076K probably damaging Het
Grm7 A G 6: 110,914,546 probably null Het
Hcn2 T C 10: 79,724,702 V289A probably benign Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Ispd G A 12: 36,473,180 V203I possibly damaging Het
Klf14 A G 6: 30,957,932 S256P possibly damaging Het
Muc6 T A 7: 141,644,222 T1214S probably benign Het
Nlrp2 T A 7: 5,325,056 D666V possibly damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Olfr1277 T C 2: 111,269,918 M150V probably benign Het
Olfr39 A G 9: 20,286,250 I184V probably benign Het
Olfr845 T A 9: 19,339,260 S267T possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pacs2 A G 12: 113,060,669 D360G probably benign Het
Pdss2 T A 10: 43,372,150 S217T probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Ppil2 A T 16: 17,096,041 F173I possibly damaging Het
Prlr C A 15: 10,328,999 T520K possibly damaging Het
Prokr2 T A 2: 132,374,092 probably null Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Reln T C 5: 21,901,743 I3210V probably benign Het
Rims2 T C 15: 39,437,526 Y218H probably damaging Het
Slc41a1 T C 1: 131,839,125 V127A probably damaging Het
St8sia6 T A 2: 13,792,751 probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Trmt1l C T 1: 151,448,343 Q314* probably null Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vnn3 G A 10: 23,867,226 V445M possibly damaging Het
Zfhx4 T C 3: 5,412,518 C3398R probably damaging Het
Zfyve16 T C 13: 92,521,312 E697G possibly damaging Het
Other mutations in Parp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Parp8 APN 13 116927323 missense probably damaging 1.00
IGL01346:Parp8 APN 13 116895064 missense possibly damaging 0.72
IGL01793:Parp8 APN 13 116910879 missense probably damaging 1.00
IGL01926:Parp8 APN 13 116862302 splice site probably benign
IGL01958:Parp8 APN 13 116876572 missense probably benign 0.14
IGL02131:Parp8 APN 13 116910873 missense probably benign 0.08
IGL02398:Parp8 APN 13 116910863 critical splice donor site probably null
IGL02496:Parp8 APN 13 116862302 splice site probably benign
IGL03135:Parp8 APN 13 116910942 missense probably benign 0.41
IGL03143:Parp8 APN 13 116910961 splice site probably benign
IGL03201:Parp8 APN 13 116863069 splice site probably benign
blondi UTSW 13 116893041 missense possibly damaging 0.77
Heidi UTSW 13 116862204 splice site probably null
R0362:Parp8 UTSW 13 116924968 nonsense probably null
R0699:Parp8 UTSW 13 116922584 missense probably benign 0.01
R1445:Parp8 UTSW 13 117025350 utr 5 prime probably null
R1676:Parp8 UTSW 13 116877528 missense probably damaging 0.99
R1977:Parp8 UTSW 13 116910913 missense probably damaging 0.96
R2019:Parp8 UTSW 13 116868432 splice site probably benign
R2049:Parp8 UTSW 13 116894886 missense probably benign 0.20
R2142:Parp8 UTSW 13 116894886 missense probably benign 0.20
R2474:Parp8 UTSW 13 116893041 missense possibly damaging 0.77
R2566:Parp8 UTSW 13 116895687 missense possibly damaging 0.78
R3863:Parp8 UTSW 13 116894767 missense probably benign 0.01
R4126:Parp8 UTSW 13 116868469 missense possibly damaging 0.94
R4519:Parp8 UTSW 13 116895673 missense possibly damaging 0.62
R4767:Parp8 UTSW 13 116868536 missense probably damaging 0.99
R5355:Parp8 UTSW 13 116862204 splice site probably null
R5633:Parp8 UTSW 13 116876580 missense probably damaging 1.00
R5942:Parp8 UTSW 13 116869433 missense probably benign 0.12
R5978:Parp8 UTSW 13 116895732 missense probably benign 0.01
R6039:Parp8 UTSW 13 116877598 missense probably damaging 1.00
R6039:Parp8 UTSW 13 116877598 missense probably damaging 1.00
R6753:Parp8 UTSW 13 116895115 missense possibly damaging 0.91
R7016:Parp8 UTSW 13 116895091 missense probably damaging 1.00
R7139:Parp8 UTSW 13 117025266 missense probably benign 0.21
R7305:Parp8 UTSW 13 116894925 missense possibly damaging 0.95
R7314:Parp8 UTSW 13 116868460 missense probably benign 0.01
R7360:Parp8 UTSW 13 116895771 missense probably benign 0.02
R7526:Parp8 UTSW 13 116894805 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACTAACTTTTGGAGACATCTC -3'
(R):5'- AGAAGTCCTTGTCAGGTGCC -3'

Sequencing Primer
(F):5'- CAGACAAATGCCCATCTATGTTTTAG -3'
(R):5'- GCCATTGGAACTGTGCTAAC -3'
Posted On2015-08-18