Incidental Mutation 'R4518:Ppil2'
ID334092
Institutional Source Beutler Lab
Gene Symbol Ppil2
Ensembl Gene ENSMUSG00000022771
Gene Namepeptidylprolyl isomerase (cyclophilin)-like 2
Synonyms
MMRRC Submission 041762-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4518 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17086555-17111257 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17096041 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 173 (F173I)
Ref Sequence ENSEMBL: ENSMUSP00000156086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023455] [ENSMUST00000115719] [ENSMUST00000115721] [ENSMUST00000164458] [ENSMUST00000231245] [ENSMUST00000231451] [ENSMUST00000231712] [ENSMUST00000232481]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023455
AA Change: F173I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023455
Gene: ENSMUSG00000022771
AA Change: F173I

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 1.3e-50 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115719
AA Change: F173I

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111384
Gene: ENSMUSG00000022771
AA Change: F173I

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115721
AA Change: F173I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111386
Gene: ENSMUSG00000022771
AA Change: F173I

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 3.7e-53 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156521
Predicted Effect possibly damaging
Transcript: ENSMUST00000164458
AA Change: F173I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131422
Gene: ENSMUSG00000022771
AA Change: F173I

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 1.3e-50 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231245
AA Change: F173I

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231287
Predicted Effect possibly damaging
Transcript: ENSMUST00000231451
AA Change: F173I

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231635
Predicted Effect possibly damaging
Transcript: ENSMUST00000231712
AA Change: F173I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232397
Predicted Effect probably benign
Transcript: ENSMUST00000232481
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cyclophilin family of peptidylprolyl isomerases. The cyclophilins are a highly conserved ubiquitous family, members of which play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. This protein interacts with the proteinase inhibitor eglin c and is localized in the nucleus. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,106,008 probably null Het
Abr A G 11: 76,472,518 S167P possibly damaging Het
Adamtsl2 T C 2: 27,095,547 L481P probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Brip1 G A 11: 86,077,878 A827V possibly damaging Het
Carns1 T G 19: 4,170,070 T389P probably benign Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cckar T C 5: 53,699,922 N311S probably damaging Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Chpf G T 1: 75,475,045 S588R probably damaging Het
Clca3a2 T A 3: 144,808,705 T414S probably damaging Het
Cntrl A G 2: 35,148,974 E1092G probably damaging Het
Crb2 C A 2: 37,790,389 T443K probably damaging Het
Cwf19l1 A G 19: 44,133,034 V25A probably damaging Het
Cyb561d1 T C 3: 108,199,571 I111V possibly damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnajb4 T C 3: 152,185,176 I329V probably benign Het
Dnmt1 G T 9: 20,911,978 D1055E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam168a C T 7: 100,834,040 A176V probably damaging Het
Farp2 A G 1: 93,620,641 E1016G probably benign Het
Fibcd1 A T 2: 31,817,195 V350E probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Golgb1 G A 16: 36,929,263 E3076K probably damaging Het
Grm7 A G 6: 110,914,546 probably null Het
Hcn2 T C 10: 79,724,702 V289A probably benign Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Ispd G A 12: 36,473,180 V203I possibly damaging Het
Klf14 A G 6: 30,957,932 S256P possibly damaging Het
Muc6 T A 7: 141,644,222 T1214S probably benign Het
Nlrp2 T A 7: 5,325,056 D666V possibly damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Olfr1277 T C 2: 111,269,918 M150V probably benign Het
Olfr39 A G 9: 20,286,250 I184V probably benign Het
Olfr845 T A 9: 19,339,260 S267T possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pacs2 A G 12: 113,060,669 D360G probably benign Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Pdss2 T A 10: 43,372,150 S217T probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Prlr C A 15: 10,328,999 T520K possibly damaging Het
Prokr2 T A 2: 132,374,092 probably null Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Reln T C 5: 21,901,743 I3210V probably benign Het
Rims2 T C 15: 39,437,526 Y218H probably damaging Het
Slc41a1 T C 1: 131,839,125 V127A probably damaging Het
St8sia6 T A 2: 13,792,751 probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Trmt1l C T 1: 151,448,343 Q314* probably null Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vnn3 G A 10: 23,867,226 V445M possibly damaging Het
Zfhx4 T C 3: 5,412,518 C3398R probably damaging Het
Zfyve16 T C 13: 92,521,312 E697G possibly damaging Het
Other mutations in Ppil2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ppil2 APN 16 17091212 missense probably damaging 1.00
IGL02392:Ppil2 APN 16 17088838 missense probably benign
IGL02559:Ppil2 APN 16 17109651 missense possibly damaging 0.80
IGL02708:Ppil2 APN 16 17106008 missense probably benign 0.03
IGL02724:Ppil2 APN 16 17103602 missense probably benign 0.08
zagnut UTSW 16 17096041 missense possibly damaging 0.62
R0592:Ppil2 UTSW 16 17107219 missense probably benign
R0975:Ppil2 UTSW 16 17107213 missense probably benign 0.00
R1258:Ppil2 UTSW 16 17106053 missense probably damaging 1.00
R1677:Ppil2 UTSW 16 17103610 missense probably damaging 1.00
R1728:Ppil2 UTSW 16 17089419 unclassified probably benign
R1739:Ppil2 UTSW 16 17089419 unclassified probably benign
R1784:Ppil2 UTSW 16 17089419 unclassified probably benign
R1853:Ppil2 UTSW 16 17107223 missense probably benign 0.00
R3608:Ppil2 UTSW 16 17092290 nonsense probably null
R3769:Ppil2 UTSW 16 17109668 missense probably benign 0.30
R4445:Ppil2 UTSW 16 17103600 nonsense probably null
R5066:Ppil2 UTSW 16 17109675 missense probably benign 0.03
R5842:Ppil2 UTSW 16 17094987 missense possibly damaging 0.66
R6013:Ppil2 UTSW 16 17100265 missense probably damaging 1.00
R6415:Ppil2 UTSW 16 17103574 critical splice donor site probably null
X0010:Ppil2 UTSW 16 17095037 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- ACCCTGGAAAGAACAGTGGC -3'
(R):5'- AGTCTGTGCCATCTTGCTTG -3'

Sequencing Primer
(F):5'- CTAACCGTCTGACAGACATGGTTG -3'
(R):5'- GCCATCTTGCTTGTCACTGGG -3'
Posted On2015-08-18