Incidental Mutation 'R4518:Ypel1'
ID 334092
Institutional Source Beutler Lab
Gene Symbol Ypel1
Ensembl Gene ENSMUSG00000022773
Gene Name yippee like 1
Synonyms 1700016N17Rik, Dgl1, Ppil2, 1700019O22Rik, mdgl-1, 0610009L05Rik, 4921520K19Rik, 4930511F14Rik
MMRRC Submission 041762-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4518 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 16887560-16904909 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 16913905 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 173 (F173I)
Ref Sequence ENSEMBL: ENSMUSP00000156086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023455] [ENSMUST00000115719] [ENSMUST00000115721] [ENSMUST00000164458] [ENSMUST00000231451] [ENSMUST00000231245] [ENSMUST00000231712] [ENSMUST00000232481]
AlphaFold Q9ESC7
Predicted Effect possibly damaging
Transcript: ENSMUST00000023455
AA Change: F173I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023455
Gene: ENSMUSG00000022771
AA Change: F173I

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 1.3e-50 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115719
AA Change: F173I

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111384
Gene: ENSMUSG00000022771
AA Change: F173I

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115721
AA Change: F173I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111386
Gene: ENSMUSG00000022771
AA Change: F173I

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 3.7e-53 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143519
Predicted Effect possibly damaging
Transcript: ENSMUST00000164458
AA Change: F173I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131422
Gene: ENSMUSG00000022771
AA Change: F173I

DomainStartEndE-ValueType
Ubox 42 101 2.53e-14 SMART
Pfam:Pro_isomerase 281 433 1.3e-50 PFAM
low complexity region 493 507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156521
Predicted Effect possibly damaging
Transcript: ENSMUST00000231451
AA Change: F173I

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000231245
AA Change: F173I

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231712
AA Change: F173I

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232323
Predicted Effect probably benign
Transcript: ENSMUST00000232481
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located in the region associated with DiGeorge syndrome on chromosome 22. The encoded protein localizes to the centrosome and nucleolus and may play a role in the regulation of cell division. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,311,006 (GRCm39) probably null Het
Abr A G 11: 76,363,344 (GRCm39) S167P possibly damaging Het
Adamtsl2 T C 2: 26,985,559 (GRCm39) L481P probably benign Het
Atp8b3 C T 10: 80,359,681 (GRCm39) M984I probably benign Het
Brip1 G A 11: 85,968,704 (GRCm39) A827V possibly damaging Het
Carns1 T G 19: 4,220,069 (GRCm39) T389P probably benign Het
Ccdc88a T C 11: 29,432,651 (GRCm39) I1219T probably benign Het
Cckar T C 5: 53,857,264 (GRCm39) N311S probably damaging Het
Cenpc1 A G 5: 86,195,446 (GRCm39) S108P possibly damaging Het
Chpf G T 1: 75,451,689 (GRCm39) S588R probably damaging Het
Clca3a2 T A 3: 144,514,466 (GRCm39) T414S probably damaging Het
Cntrl A G 2: 35,038,986 (GRCm39) E1092G probably damaging Het
Crb2 C A 2: 37,680,401 (GRCm39) T443K probably damaging Het
Crppa G A 12: 36,523,179 (GRCm39) V203I possibly damaging Het
Cwf19l1 A G 19: 44,121,473 (GRCm39) V25A probably damaging Het
Cyb561d1 T C 3: 108,106,887 (GRCm39) I111V possibly damaging Het
Dbn1 A T 13: 55,624,042 (GRCm39) I350N possibly damaging Het
Dnajb4 T C 3: 151,890,813 (GRCm39) I329V probably benign Het
Dnmt1 G T 9: 20,823,274 (GRCm39) D1055E probably benign Het
Fam168a C T 7: 100,483,247 (GRCm39) A176V probably damaging Het
Farp2 A G 1: 93,548,363 (GRCm39) E1016G probably benign Het
Fibcd1 A T 2: 31,707,207 (GRCm39) V350E probably damaging Het
Galnt3 C A 2: 65,923,954 (GRCm39) R438L probably damaging Het
Golga4 T A 9: 118,388,076 (GRCm39) S1733T probably benign Het
Golgb1 G A 16: 36,749,625 (GRCm39) E3076K probably damaging Het
Grm7 A G 6: 110,891,507 (GRCm39) probably null Het
Hcn2 T C 10: 79,560,536 (GRCm39) V289A probably benign Het
Hipk1 G T 3: 103,657,688 (GRCm39) H799N probably damaging Het
Klf14 A G 6: 30,934,867 (GRCm39) S256P possibly damaging Het
Muc6 T A 7: 141,230,489 (GRCm39) T1214S probably benign Het
Nlrp2 T A 7: 5,328,055 (GRCm39) D666V possibly damaging Het
Ntng1 A G 3: 109,842,329 (GRCm39) I148T probably damaging Het
Or4k35 T C 2: 111,100,263 (GRCm39) M150V probably benign Het
Or7d9 A G 9: 20,197,546 (GRCm39) I184V probably benign Het
Or7g27 T A 9: 19,250,556 (GRCm39) S267T possibly damaging Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Pacs2 A G 12: 113,024,289 (GRCm39) D360G probably benign Het
Parp8 C A 13: 117,032,209 (GRCm39) L321F possibly damaging Het
Pdss2 T A 10: 43,248,146 (GRCm39) S217T probably damaging Het
Plekhn1 T C 4: 156,309,988 (GRCm39) S109G probably damaging Het
Prlr C A 15: 10,329,085 (GRCm39) T520K possibly damaging Het
Prokr2 T A 2: 132,216,012 (GRCm39) probably null Het
Rab3gap2 G A 1: 184,999,265 (GRCm39) V991I probably benign Het
Reln T C 5: 22,106,741 (GRCm39) I3210V probably benign Het
Rims2 T C 15: 39,300,922 (GRCm39) Y218H probably damaging Het
Slc41a1 T C 1: 131,766,863 (GRCm39) V127A probably damaging Het
St8sia6 T A 2: 13,797,562 (GRCm39) probably null Het
Tlr6 A G 5: 65,112,247 (GRCm39) F220S possibly damaging Het
Trmt1l C T 1: 151,324,094 (GRCm39) Q314* probably null Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Vnn3 G A 10: 23,743,124 (GRCm39) V445M possibly damaging Het
Zfhx4 T C 3: 5,477,578 (GRCm39) C3398R probably damaging Het
Zfyve16 T C 13: 92,657,820 (GRCm39) E697G possibly damaging Het
Other mutations in Ypel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ypel1 APN 16 16,909,076 (GRCm39) missense probably damaging 1.00
IGL02392:Ypel1 APN 16 16,906,702 (GRCm39) missense probably benign
IGL02559:Ypel1 APN 16 16,927,515 (GRCm39) missense possibly damaging 0.80
IGL02708:Ypel1 APN 16 16,923,872 (GRCm39) missense probably benign 0.03
IGL02724:Ypel1 APN 16 16,921,466 (GRCm39) missense probably benign 0.08
zagnut UTSW 16 16,913,905 (GRCm39) missense possibly damaging 0.62
R0592:Ypel1 UTSW 16 16,925,083 (GRCm39) missense probably benign
R0975:Ypel1 UTSW 16 16,925,077 (GRCm39) missense probably benign 0.00
R1258:Ypel1 UTSW 16 16,923,917 (GRCm39) missense probably damaging 1.00
R1594:Ypel1 UTSW 16 16,899,985 (GRCm39) missense probably damaging 1.00
R1677:Ypel1 UTSW 16 16,921,474 (GRCm39) missense probably damaging 1.00
R1728:Ypel1 UTSW 16 16,907,283 (GRCm39) unclassified probably benign
R1739:Ypel1 UTSW 16 16,907,283 (GRCm39) unclassified probably benign
R1784:Ypel1 UTSW 16 16,907,283 (GRCm39) unclassified probably benign
R1853:Ypel1 UTSW 16 16,925,087 (GRCm39) missense probably benign 0.00
R1856:Ypel1 UTSW 16 16,899,511 (GRCm39) splice site probably null
R1921:Ypel1 UTSW 16 16,900,443 (GRCm39) missense probably benign 0.00
R3608:Ypel1 UTSW 16 16,910,154 (GRCm39) nonsense probably null
R3769:Ypel1 UTSW 16 16,927,532 (GRCm39) missense probably benign 0.30
R4445:Ypel1 UTSW 16 16,921,464 (GRCm39) nonsense probably null
R5066:Ypel1 UTSW 16 16,927,539 (GRCm39) missense probably benign 0.03
R5085:Ypel1 UTSW 16 16,902,472 (GRCm39) splice site probably null
R5842:Ypel1 UTSW 16 16,912,851 (GRCm39) missense possibly damaging 0.66
R6013:Ypel1 UTSW 16 16,918,129 (GRCm39) missense probably damaging 1.00
R6030:Ypel1 UTSW 16 16,902,377 (GRCm39) splice site probably null
R6030:Ypel1 UTSW 16 16,902,377 (GRCm39) splice site probably null
R6415:Ypel1 UTSW 16 16,921,438 (GRCm39) critical splice donor site probably null
R6978:Ypel1 UTSW 16 16,902,438 (GRCm39) missense probably benign 0.01
R7735:Ypel1 UTSW 16 16,918,124 (GRCm39) missense probably benign 0.11
R8865:Ypel1 UTSW 16 16,915,269 (GRCm39) missense probably benign 0.02
R9173:Ypel1 UTSW 16 16,915,298 (GRCm39) nonsense probably null
R9720:Ypel1 UTSW 16 16,910,890 (GRCm39) missense probably damaging 0.99
RF014:Ypel1 UTSW 16 16,915,282 (GRCm39) missense probably damaging 1.00
X0010:Ypel1 UTSW 16 16,912,901 (GRCm39) missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- ACCCTGGAAAGAACAGTGGC -3'
(R):5'- AGTCTGTGCCATCTTGCTTG -3'

Sequencing Primer
(F):5'- CTAACCGTCTGACAGACATGGTTG -3'
(R):5'- GCCATCTTGCTTGTCACTGGG -3'
Posted On 2015-08-18