Incidental Mutation 'R4519:Atp8b4'
ID334104
Institutional Source Beutler Lab
Gene Symbol Atp8b4
Ensembl Gene ENSMUSG00000060131
Gene NameATPase, class I, type 8B, member 4
SynonymsIm
MMRRC Submission 041590-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4519 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location126320973-126500674 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 126414459 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040128] [ENSMUST00000040128] [ENSMUST00000040128] [ENSMUST00000040128] [ENSMUST00000040149] [ENSMUST00000040149] [ENSMUST00000129187] [ENSMUST00000129187] [ENSMUST00000129187] [ENSMUST00000129187] [ENSMUST00000147517] [ENSMUST00000147517]
Predicted Effect probably null
Transcript: ENSMUST00000040128
SMART Domains Protein: ENSMUSP00000046444
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 3.4e-30 PFAM
Pfam:E1-E2_ATPase 81 352 5.1e-8 PFAM
Pfam:HAD 390 826 1.1e-18 PFAM
Pfam:Cation_ATPase 474 573 5.5e-10 PFAM
Pfam:PhoLip_ATPase_C 843 1097 1.6e-83 PFAM
low complexity region 1113 1130 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000040128
SMART Domains Protein: ENSMUSP00000046444
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 3.4e-30 PFAM
Pfam:E1-E2_ATPase 81 352 5.1e-8 PFAM
Pfam:HAD 390 826 1.1e-18 PFAM
Pfam:Cation_ATPase 474 573 5.5e-10 PFAM
Pfam:PhoLip_ATPase_C 843 1097 1.6e-83 PFAM
low complexity region 1113 1130 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000040128
SMART Domains Protein: ENSMUSP00000046444
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 3.4e-30 PFAM
Pfam:E1-E2_ATPase 81 352 5.1e-8 PFAM
Pfam:HAD 390 826 1.1e-18 PFAM
Pfam:Cation_ATPase 474 573 5.5e-10 PFAM
Pfam:PhoLip_ATPase_C 843 1097 1.6e-83 PFAM
low complexity region 1113 1130 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000040128
SMART Domains Protein: ENSMUSP00000046444
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 3.4e-30 PFAM
Pfam:E1-E2_ATPase 81 352 5.1e-8 PFAM
Pfam:HAD 390 826 1.1e-18 PFAM
Pfam:Cation_ATPase 474 573 5.5e-10 PFAM
Pfam:PhoLip_ATPase_C 843 1097 1.6e-83 PFAM
low complexity region 1113 1130 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000040149
SMART Domains Protein: ENSMUSP00000047302
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 3.4e-30 PFAM
Pfam:E1-E2_ATPase 81 352 5.1e-8 PFAM
Pfam:HAD 390 826 1.1e-18 PFAM
Pfam:Cation_ATPase 474 573 5.5e-10 PFAM
Pfam:PhoLip_ATPase_C 843 1097 1.6e-83 PFAM
low complexity region 1113 1130 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000040149
SMART Domains Protein: ENSMUSP00000047302
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 3.4e-30 PFAM
Pfam:E1-E2_ATPase 81 352 5.1e-8 PFAM
Pfam:HAD 390 826 1.1e-18 PFAM
Pfam:Cation_ATPase 474 573 5.5e-10 PFAM
Pfam:PhoLip_ATPase_C 843 1097 1.6e-83 PFAM
low complexity region 1113 1130 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129187
SMART Domains Protein: ENSMUSP00000118651
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Blast:CUB 32 67 2e-7 BLAST
Pfam:E1-E2_ATPase 84 355 1.6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129187
SMART Domains Protein: ENSMUSP00000118651
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Blast:CUB 32 67 2e-7 BLAST
Pfam:E1-E2_ATPase 84 355 1.6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129187
SMART Domains Protein: ENSMUSP00000118651
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Blast:CUB 32 67 2e-7 BLAST
Pfam:E1-E2_ATPase 84 355 1.6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129187
SMART Domains Protein: ENSMUSP00000118651
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Blast:CUB 32 67 2e-7 BLAST
Pfam:E1-E2_ATPase 84 355 1.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134977
Predicted Effect probably benign
Transcript: ENSMUST00000147517
SMART Domains Protein: ENSMUSP00000114252
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Blast:CUB 32 67 2e-7 BLAST
Pfam:E1-E2_ATPase 84 355 1.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147517
SMART Domains Protein: ENSMUSP00000114252
Gene: ENSMUSG00000060131

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Blast:CUB 32 67 2e-7 BLAST
Pfam:E1-E2_ATPase 84 355 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cation transport ATPase (P-type) family and type IV subfamily. The encoded protein is involved in phospholipid transport in the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A G 9: 114,300,024 noncoding transcript Het
Acadsb A T 7: 131,430,004 T190S probably damaging Het
Adamts17 G T 7: 66,840,566 G132V probably damaging Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Btbd18 T C 2: 84,667,580 Y521H probably damaging Het
Casd1 A G 6: 4,621,102 N220S probably benign Het
Ccdc112 T G 18: 46,287,546 E379A possibly damaging Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cntrl A T 2: 35,173,111 K1573M probably damaging Het
Col14a1 A T 15: 55,388,579 I544F unknown Het
Cyp20a1 A T 1: 60,387,147 Y416F probably damaging Het
Dagla T C 19: 10,269,732 K132E probably damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Ddx41 A T 13: 55,533,144 V329E probably damaging Het
Dhx32 A T 7: 133,734,109 Y272N probably damaging Het
Fam114a1 C A 5: 65,005,882 P174Q probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam214a A G 9: 75,023,647 I957M probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Ghr T A 15: 3,333,488 L167F probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm9767 T C 10: 26,078,858 probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Gsdme A T 6: 50,229,353 I170N probably damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Kmt2c T A 5: 25,363,477 K867M probably damaging Het
Krt35 A G 11: 100,094,627 V196A possibly damaging Het
Ltbp1 A T 17: 75,364,497 M1558L probably benign Het
Mcam T G 9: 44,141,343 M623R possibly damaging Het
Mrps26 A T 2: 130,564,349 Q134L probably benign Het
Mxra8 T C 4: 155,842,983 probably null Het
Olfr532 A G 7: 140,419,210 S188P probably damaging Het
Olfr659 G A 7: 104,670,839 G46R probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Parg C A 14: 32,209,635 T404K probably damaging Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Piezo2 T C 18: 63,072,880 E1486G probably damaging Het
Pign A T 1: 105,597,666 probably null Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Ppp6r1 A C 7: 4,641,046 probably null Het
Ptdss2 A G 7: 141,154,578 T309A probably benign Het
Ptprt T C 2: 161,564,689 M987V probably damaging Het
Rgs17 C A 10: 5,918,192 L9F probably benign Het
Rock2 A G 12: 16,977,737 R168G probably damaging Het
Rsph4a T A 10: 33,911,627 L593* probably null Het
Scaf11 C A 15: 96,424,838 K108N probably damaging Het
Sec23b T A 2: 144,582,015 M528K possibly damaging Het
Shank2 G A 7: 144,410,205 D727N probably damaging Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Spatc1 A T 15: 76,292,485 I479F probably damaging Het
Tmem126b A G 7: 90,469,108 L188P probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Vmn2r62 A G 7: 42,764,533 F829L probably damaging Het
Other mutations in Atp8b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Atp8b4 APN 2 126358897 missense probably damaging 1.00
IGL00841:Atp8b4 APN 2 126383769 missense probably damaging 0.97
IGL00917:Atp8b4 APN 2 126374533 missense probably benign 0.00
IGL01013:Atp8b4 APN 2 126323087 missense probably benign 0.25
IGL01374:Atp8b4 APN 2 126383657 splice site probably benign
IGL01898:Atp8b4 APN 2 126389361 missense probably benign 0.00
IGL01927:Atp8b4 APN 2 126322976 missense probably damaging 0.99
IGL01971:Atp8b4 APN 2 126462616 missense probably benign 0.05
R0320:Atp8b4 UTSW 2 126459694 missense possibly damaging 0.55
R0441:Atp8b4 UTSW 2 126378706 splice site probably benign
R0526:Atp8b4 UTSW 2 126427363 missense probably damaging 1.00
R0765:Atp8b4 UTSW 2 126372150 splice site probably null
R0964:Atp8b4 UTSW 2 126337493 missense probably damaging 1.00
R1386:Atp8b4 UTSW 2 126378744 missense probably benign 0.00
R1401:Atp8b4 UTSW 2 126323093 critical splice acceptor site probably null
R1568:Atp8b4 UTSW 2 126325394 missense probably benign
R1792:Atp8b4 UTSW 2 126325294 missense probably benign
R1830:Atp8b4 UTSW 2 126403381 missense probably benign 0.03
R1839:Atp8b4 UTSW 2 126361782 missense possibly damaging 0.92
R1984:Atp8b4 UTSW 2 126323008 missense probably damaging 1.00
R2143:Atp8b4 UTSW 2 126374510 missense probably damaging 1.00
R2186:Atp8b4 UTSW 2 126358860 missense probably damaging 1.00
R2212:Atp8b4 UTSW 2 126375757 missense probably damaging 1.00
R2473:Atp8b4 UTSW 2 126358894 missense possibly damaging 0.67
R3412:Atp8b4 UTSW 2 126375757 missense probably damaging 1.00
R3414:Atp8b4 UTSW 2 126375757 missense probably damaging 1.00
R4543:Atp8b4 UTSW 2 126358066 missense probably damaging 0.97
R4701:Atp8b4 UTSW 2 126414293 missense probably damaging 1.00
R4818:Atp8b4 UTSW 2 126322816 missense probably benign 0.01
R4895:Atp8b4 UTSW 2 126414369 missense probably benign 0.23
R5213:Atp8b4 UTSW 2 126389409 splice site probably null
R5239:Atp8b4 UTSW 2 126392861 splice site probably null
R5241:Atp8b4 UTSW 2 126383726 missense probably benign
R5654:Atp8b4 UTSW 2 126375805 missense probably damaging 1.00
R5725:Atp8b4 UTSW 2 126433936 missense probably benign
R5771:Atp8b4 UTSW 2 126378744 missense probably benign 0.11
R5949:Atp8b4 UTSW 2 126405322 missense probably benign 0.02
R5993:Atp8b4 UTSW 2 126403234 missense probably benign
R5998:Atp8b4 UTSW 2 126433867 splice site probably null
R6550:Atp8b4 UTSW 2 126424193 missense probably damaging 1.00
R6575:Atp8b4 UTSW 2 126414364 missense probably damaging 1.00
R6892:Atp8b4 UTSW 2 126343002 missense possibly damaging 0.94
R6915:Atp8b4 UTSW 2 126358914 nonsense probably null
R7045:Atp8b4 UTSW 2 126372195 missense probably benign 0.00
R7206:Atp8b4 UTSW 2 126458292 missense probably damaging 0.99
R7349:Atp8b4 UTSW 2 126325345 missense probably benign 0.00
R7395:Atp8b4 UTSW 2 126375694 missense possibly damaging 0.76
R7429:Atp8b4 UTSW 2 126403371 missense possibly damaging 0.47
R7430:Atp8b4 UTSW 2 126403371 missense possibly damaging 0.47
R7548:Atp8b4 UTSW 2 126389342 missense probably benign
R7724:Atp8b4 UTSW 2 126322893 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCCCGAGTCTATACACTGTACC -3'
(R):5'- CTGGTCAGTATAGAGAATCTTGCTTC -3'

Sequencing Primer
(F):5'- GTCTATACACTGTACCTGCAAAAAG -3'
(R):5'- CCACAGTCTTGCATGTGT -3'
Posted On2015-08-18