Incidental Mutation 'R4519:Ptprt'
ID 334107
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Name protein tyrosine phosphatase receptor type T
Synonyms RPTPrho
MMRRC Submission 041590-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R4519 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 161363910-162503067 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 161406609 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 987 (M987V)
Ref Sequence ENSEMBL: ENSMUSP00000105068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109441
AA Change: M968V

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: M968V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109442
AA Change: M987V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: M987V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: M978V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: M978V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109445
AA Change: M968V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: M968V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A G 9: 114,129,092 (GRCm39) noncoding transcript Het
Acadsb A T 7: 131,031,733 (GRCm39) T190S probably damaging Het
Adamts17 G T 7: 66,490,314 (GRCm39) G132V probably damaging Het
Atosa A G 9: 74,930,929 (GRCm39) I957M probably damaging Het
Atp8b3 C T 10: 80,359,681 (GRCm39) M984I probably benign Het
Atp8b4 A T 2: 126,256,379 (GRCm39) probably null Het
Btbd18 T C 2: 84,497,924 (GRCm39) Y521H probably damaging Het
Casd1 A G 6: 4,621,102 (GRCm39) N220S probably benign Het
Ccdc112 T G 18: 46,420,613 (GRCm39) E379A possibly damaging Het
Ccdc88a T C 11: 29,432,651 (GRCm39) I1219T probably benign Het
Cntrl A T 2: 35,063,123 (GRCm39) K1573M probably damaging Het
Col14a1 A T 15: 55,251,975 (GRCm39) I544F unknown Het
Cyp20a1 A T 1: 60,426,306 (GRCm39) Y416F probably damaging Het
Dagla T C 19: 10,247,096 (GRCm39) K132E probably damaging Het
Dbn1 A T 13: 55,624,042 (GRCm39) I350N possibly damaging Het
Ddx41 A T 13: 55,680,957 (GRCm39) V329E probably damaging Het
Dhx32 A T 7: 133,335,838 (GRCm39) Y272N probably damaging Het
Fam114a1 C A 5: 65,163,225 (GRCm39) P174Q probably benign Het
Galnt3 C A 2: 65,923,954 (GRCm39) R438L probably damaging Het
Ghr T A 15: 3,362,970 (GRCm39) L167F probably damaging Het
Glod4 T A 11: 76,134,397 (GRCm39) D25V probably damaging Het
Gm9767 T C 10: 25,954,756 (GRCm39) probably benign Het
Golga4 T A 9: 118,388,076 (GRCm39) S1733T probably benign Het
Gsdme A T 6: 50,206,333 (GRCm39) I170N probably damaging Het
H2-M10.3 C T 17: 36,678,722 (GRCm39) probably null Het
Kmt2c T A 5: 25,568,475 (GRCm39) K867M probably damaging Het
Krt35 A G 11: 99,985,453 (GRCm39) V196A possibly damaging Het
Ltbp1 A T 17: 75,671,492 (GRCm39) M1558L probably benign Het
Mcam T G 9: 44,052,640 (GRCm39) M623R possibly damaging Het
Mrps26 A T 2: 130,406,269 (GRCm39) Q134L probably benign Het
Mxra8 T C 4: 155,927,440 (GRCm39) probably null Het
Or13a21 A G 7: 139,999,123 (GRCm39) S188P probably damaging Het
Or52n20 G A 7: 104,320,046 (GRCm39) G46R probably damaging Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Parg C A 14: 31,931,592 (GRCm39) T404K probably damaging Het
Parp8 C A 13: 117,032,209 (GRCm39) L321F possibly damaging Het
Piezo2 T C 18: 63,205,951 (GRCm39) E1486G probably damaging Het
Pign A T 1: 105,525,391 (GRCm39) probably null Het
Pik3r4 A G 9: 105,549,924 (GRCm39) H1005R probably damaging Het
Ppp6r1 A C 7: 4,644,045 (GRCm39) probably null Het
Ptdss2 A G 7: 140,734,491 (GRCm39) T309A probably benign Het
Rgs17 C A 10: 5,868,192 (GRCm39) L9F probably benign Het
Rock2 A G 12: 17,027,738 (GRCm39) R168G probably damaging Het
Rsph4a T A 10: 33,787,623 (GRCm39) L593* probably null Het
Scaf11 C A 15: 96,322,719 (GRCm39) K108N probably damaging Het
Sec23b T A 2: 144,423,935 (GRCm39) M528K possibly damaging Het
Shank2 G A 7: 143,963,942 (GRCm39) D727N probably damaging Het
Sipa1l2 T C 8: 126,218,965 (GRCm39) D124G probably benign Het
Spatc1 A T 15: 76,176,685 (GRCm39) I479F probably damaging Het
Tmem126b A G 7: 90,118,316 (GRCm39) L188P probably damaging Het
Tnrc6b T G 15: 80,764,448 (GRCm39) L650W probably damaging Het
Vmn2r62 A G 7: 42,413,957 (GRCm39) F829L probably damaging Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161,652,544 (GRCm39) missense probably benign 0.00
IGL00565:Ptprt APN 2 161,402,111 (GRCm39) missense probably damaging 1.00
IGL00925:Ptprt APN 2 161,498,083 (GRCm39) missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161,393,737 (GRCm39) missense probably damaging 1.00
IGL01432:Ptprt APN 2 162,109,999 (GRCm39) splice site probably benign
IGL02008:Ptprt APN 2 161,769,593 (GRCm39) missense probably benign 0.02
IGL02040:Ptprt APN 2 162,079,992 (GRCm39) missense probably damaging 1.00
IGL02172:Ptprt APN 2 161,397,422 (GRCm39) missense probably damaging 1.00
IGL02231:Ptprt APN 2 162,119,966 (GRCm39) critical splice donor site probably null
IGL02231:Ptprt APN 2 162,079,980 (GRCm39) missense probably damaging 1.00
IGL02232:Ptprt APN 2 161,372,437 (GRCm39) missense probably damaging 0.96
IGL02277:Ptprt APN 2 161,389,301 (GRCm39) missense probably damaging 1.00
IGL02447:Ptprt APN 2 162,120,027 (GRCm39) missense probably benign 0.01
IGL02601:Ptprt APN 2 161,608,227 (GRCm39) missense probably benign 0.10
IGL02623:Ptprt APN 2 161,449,372 (GRCm39) splice site probably benign
IGL03379:Ptprt APN 2 161,397,379 (GRCm39) nonsense probably null
Poverina UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161,375,533 (GRCm39) missense probably damaging 0.96
R0064:Ptprt UTSW 2 161,769,711 (GRCm39) splice site probably benign
R0129:Ptprt UTSW 2 162,119,990 (GRCm39) missense probably benign 0.35
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0132:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0316:Ptprt UTSW 2 161,449,239 (GRCm39) missense probably damaging 1.00
R0454:Ptprt UTSW 2 161,395,742 (GRCm39) missense probably damaging 0.96
R0488:Ptprt UTSW 2 161,395,745 (GRCm39) missense probably damaging 0.99
R0573:Ptprt UTSW 2 161,393,668 (GRCm39) missense probably damaging 1.00
R0614:Ptprt UTSW 2 161,654,040 (GRCm39) missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161,654,059 (GRCm39) splice site probably null
R1023:Ptprt UTSW 2 161,400,863 (GRCm39) missense probably damaging 1.00
R1184:Ptprt UTSW 2 161,769,692 (GRCm39) missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162,120,146 (GRCm39) missense probably damaging 1.00
R1476:Ptprt UTSW 2 161,769,404 (GRCm39) missense probably damaging 1.00
R1515:Ptprt UTSW 2 162,079,954 (GRCm39) missense probably damaging 1.00
R1595:Ptprt UTSW 2 161,652,469 (GRCm39) critical splice donor site probably null
R1939:Ptprt UTSW 2 161,769,560 (GRCm39) missense probably benign 0.45
R1987:Ptprt UTSW 2 161,608,241 (GRCm39) missense possibly damaging 0.48
R1987:Ptprt UTSW 2 161,400,818 (GRCm39) missense probably damaging 1.00
R2049:Ptprt UTSW 2 161,376,465 (GRCm39) missense probably damaging 1.00
R2140:Ptprt UTSW 2 161,653,908 (GRCm39) missense probably damaging 1.00
R2421:Ptprt UTSW 2 162,119,960 (GRCm39) splice site probably benign
R3432:Ptprt UTSW 2 161,769,449 (GRCm39) missense probably damaging 1.00
R3619:Ptprt UTSW 2 161,408,077 (GRCm39) missense probably damaging 1.00
R3757:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3758:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3834:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3835:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3915:Ptprt UTSW 2 161,397,475 (GRCm39) splice site probably benign
R4003:Ptprt UTSW 2 161,408,037 (GRCm39) splice site probably benign
R4387:Ptprt UTSW 2 161,769,570 (GRCm39) missense probably damaging 1.00
R4618:Ptprt UTSW 2 161,395,765 (GRCm39) missense probably damaging 1.00
R4677:Ptprt UTSW 2 161,743,366 (GRCm39) critical splice donor site probably null
R4866:Ptprt UTSW 2 161,402,159 (GRCm39) missense probably damaging 1.00
R5088:Ptprt UTSW 2 162,080,095 (GRCm39) missense probably benign 0.01
R5173:Ptprt UTSW 2 161,769,676 (GRCm39) missense probably benign 0.01
R5215:Ptprt UTSW 2 162,120,084 (GRCm39) missense probably damaging 1.00
R5383:Ptprt UTSW 2 161,539,969 (GRCm39) missense probably damaging 1.00
R5398:Ptprt UTSW 2 161,769,512 (GRCm39) missense probably damaging 1.00
R5518:Ptprt UTSW 2 162,120,143 (GRCm39) missense probably damaging 0.99
R5711:Ptprt UTSW 2 161,652,524 (GRCm39) missense probably damaging 0.98
R5735:Ptprt UTSW 2 161,376,484 (GRCm39) missense probably damaging 0.98
R5834:Ptprt UTSW 2 161,402,189 (GRCm39) missense probably damaging 1.00
R5872:Ptprt UTSW 2 161,977,138 (GRCm39) missense probably damaging 1.00
R5926:Ptprt UTSW 2 161,406,606 (GRCm39) missense probably benign 0.00
R6210:Ptprt UTSW 2 162,109,949 (GRCm39) missense probably damaging 1.00
R6285:Ptprt UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161,395,779 (GRCm39) missense probably damaging 1.00
R6406:Ptprt UTSW 2 161,395,703 (GRCm39) missense probably damaging 0.98
R6499:Ptprt UTSW 2 161,376,507 (GRCm39) missense probably benign 0.32
R6613:Ptprt UTSW 2 161,372,367 (GRCm39) missense probably damaging 1.00
R6622:Ptprt UTSW 2 161,395,760 (GRCm39) missense probably damaging 1.00
R7218:Ptprt UTSW 2 161,389,284 (GRCm39) missense probably damaging 1.00
R7247:Ptprt UTSW 2 161,375,443 (GRCm39) missense probably benign 0.15
R7576:Ptprt UTSW 2 161,449,225 (GRCm39) missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161,417,707 (GRCm39) missense probably damaging 1.00
R7735:Ptprt UTSW 2 161,417,661 (GRCm39) missense probably damaging 1.00
R7813:Ptprt UTSW 2 161,372,413 (GRCm39) missense probably damaging 1.00
R8031:Ptprt UTSW 2 161,977,377 (GRCm39) missense probably damaging 1.00
R8074:Ptprt UTSW 2 161,769,581 (GRCm39) missense possibly damaging 0.77
R8151:Ptprt UTSW 2 162,120,005 (GRCm39) missense probably damaging 1.00
R8236:Ptprt UTSW 2 161,528,988 (GRCm39) critical splice donor site probably null
R8308:Ptprt UTSW 2 161,769,566 (GRCm39) missense probably benign 0.00
R8348:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8362:Ptprt UTSW 2 161,393,667 (GRCm39) missense probably damaging 1.00
R8365:Ptprt UTSW 2 161,743,451 (GRCm39) missense probably benign 0.05
R8448:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8512:Ptprt UTSW 2 161,400,783 (GRCm39) missense probably benign 0.00
R8715:Ptprt UTSW 2 161,372,463 (GRCm39) missense probably damaging 1.00
R9004:Ptprt UTSW 2 161,608,314 (GRCm39) missense probably benign 0.04
R9046:Ptprt UTSW 2 161,372,361 (GRCm39) missense possibly damaging 0.58
R9222:Ptprt UTSW 2 161,402,106 (GRCm39) missense probably damaging 1.00
R9297:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9318:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9476:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9510:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9571:Ptprt UTSW 2 161,395,732 (GRCm39) missense probably benign 0.10
X0064:Ptprt UTSW 2 161,769,403 (GRCm39) missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162,080,041 (GRCm39) missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 162,204,868 (GRCm39) missense possibly damaging 0.77
Z1177:Ptprt UTSW 2 161,574,807 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGATGCTGCTCAGATGTG -3'
(R):5'- AACTTGGTATTCCACTAGGGCTC -3'

Sequencing Primer
(F):5'- CATCCCTGTAGGCTGCTGTAAG -3'
(R):5'- AGGGCTCCTCTACACTCG -3'
Posted On 2015-08-18