Incidental Mutation 'R4519:Shank2'
ID334122
Institutional Source Beutler Lab
Gene Symbol Shank2
Ensembl Gene ENSMUSG00000037541
Gene NameSH3 and multiple ankyrin repeat domains 2
SynonymsProSAP1
MMRRC Submission 041590-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4519 (G1)
Quality Score197
Status Not validated
Chromosome7
Chromosomal Location144001928-144424494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 144410205 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 727 (D727N)
Ref Sequence ENSEMBL: ENSMUSP00000101520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097929] [ENSMUST00000105900] [ENSMUST00000105902] [ENSMUST00000146006]
Predicted Effect probably damaging
Transcript: ENSMUST00000097929
AA Change: D510N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095542
Gene: ENSMUSG00000037541
AA Change: D510N

DomainStartEndE-ValueType
PDZ 46 131 1.75e-14 SMART
low complexity region 135 154 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
low complexity region 814 828 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 915 937 N/A INTRINSIC
low complexity region 951 967 N/A INTRINSIC
low complexity region 989 997 N/A INTRINSIC
low complexity region 1077 1091 N/A INTRINSIC
low complexity region 1134 1149 N/A INTRINSIC
low complexity region 1173 1187 N/A INTRINSIC
SAM 1196 1262 2.52e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105900
AA Change: D727N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101520
Gene: ENSMUSG00000037541
AA Change: D727N

DomainStartEndE-ValueType
SH3 150 205 1.04e-14 SMART
PDZ 256 341 1.75e-14 SMART
low complexity region 345 364 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
low complexity region 662 674 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 780 792 N/A INTRINSIC
low complexity region 829 847 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
low complexity region 1125 1147 N/A INTRINSIC
low complexity region 1161 1177 N/A INTRINSIC
low complexity region 1199 1207 N/A INTRINSIC
low complexity region 1287 1301 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
SAM 1406 1472 2.52e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105902
AA Change: D1096N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: D1096N

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:FERM_f0 57 140 1.4e-21 PFAM
ANK 196 226 1.4e1 SMART
ANK 230 259 2.77e-3 SMART
ANK 263 293 1.42e0 SMART
ANK 297 326 1.25e-1 SMART
ANK 330 359 7.83e-3 SMART
ANK 363 391 1.29e2 SMART
SH3 529 584 1.04e-14 SMART
PDZ 635 720 1.75e-14 SMART
low complexity region 724 743 N/A INTRINSIC
low complexity region 878 893 N/A INTRINSIC
low complexity region 1031 1043 N/A INTRINSIC
low complexity region 1118 1129 N/A INTRINSIC
low complexity region 1149 1161 N/A INTRINSIC
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1462 1473 N/A INTRINSIC
low complexity region 1494 1516 N/A INTRINSIC
low complexity region 1530 1546 N/A INTRINSIC
low complexity region 1568 1576 N/A INTRINSIC
low complexity region 1656 1670 N/A INTRINSIC
low complexity region 1713 1728 N/A INTRINSIC
low complexity region 1752 1766 N/A INTRINSIC
SAM 1775 1841 2.52e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125355
Predicted Effect probably damaging
Transcript: ENSMUST00000146006
AA Change: D517N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A G 9: 114,300,024 noncoding transcript Het
Acadsb A T 7: 131,430,004 T190S probably damaging Het
Adamts17 G T 7: 66,840,566 G132V probably damaging Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Atp8b4 A T 2: 126,414,459 probably null Het
Btbd18 T C 2: 84,667,580 Y521H probably damaging Het
Casd1 A G 6: 4,621,102 N220S probably benign Het
Ccdc112 T G 18: 46,287,546 E379A possibly damaging Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cntrl A T 2: 35,173,111 K1573M probably damaging Het
Col14a1 A T 15: 55,388,579 I544F unknown Het
Cyp20a1 A T 1: 60,387,147 Y416F probably damaging Het
Dagla T C 19: 10,269,732 K132E probably damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Ddx41 A T 13: 55,533,144 V329E probably damaging Het
Dhx32 A T 7: 133,734,109 Y272N probably damaging Het
Fam114a1 C A 5: 65,005,882 P174Q probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam214a A G 9: 75,023,647 I957M probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Ghr T A 15: 3,333,488 L167F probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm9767 T C 10: 26,078,858 probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Gsdme A T 6: 50,229,353 I170N probably damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Kmt2c T A 5: 25,363,477 K867M probably damaging Het
Krt35 A G 11: 100,094,627 V196A possibly damaging Het
Ltbp1 A T 17: 75,364,497 M1558L probably benign Het
Mcam T G 9: 44,141,343 M623R possibly damaging Het
Mrps26 A T 2: 130,564,349 Q134L probably benign Het
Mxra8 T C 4: 155,842,983 probably null Het
Olfr532 A G 7: 140,419,210 S188P probably damaging Het
Olfr659 G A 7: 104,670,839 G46R probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Parg C A 14: 32,209,635 T404K probably damaging Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Piezo2 T C 18: 63,072,880 E1486G probably damaging Het
Pign A T 1: 105,597,666 probably null Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Ppp6r1 A C 7: 4,641,046 probably null Het
Ptdss2 A G 7: 141,154,578 T309A probably benign Het
Ptprt T C 2: 161,564,689 M987V probably damaging Het
Rgs17 C A 10: 5,918,192 L9F probably benign Het
Rock2 A G 12: 16,977,737 R168G probably damaging Het
Rsph4a T A 10: 33,911,627 L593* probably null Het
Scaf11 C A 15: 96,424,838 K108N probably damaging Het
Sec23b T A 2: 144,582,015 M528K possibly damaging Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Spatc1 A T 15: 76,292,485 I479F probably damaging Het
Tmem126b A G 7: 90,469,108 L188P probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Vmn2r62 A G 7: 42,764,533 F829L probably damaging Het
Other mutations in Shank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Shank2 APN 7 144411847 missense probably damaging 1.00
IGL00516:Shank2 APN 7 144410775 missense possibly damaging 0.96
IGL00919:Shank2 APN 7 144411271 missense probably damaging 0.97
IGL01450:Shank2 APN 7 144285068 nonsense probably null
IGL01996:Shank2 APN 7 144411493 missense probably damaging 1.00
IGL02217:Shank2 APN 7 144285047 missense possibly damaging 0.59
IGL02314:Shank2 APN 7 144411271 missense probably benign 0.01
IGL02320:Shank2 APN 7 144420944 missense probably damaging 1.00
IGL02948:Shank2 APN 7 144409636 missense probably benign 0.03
IGL02997:Shank2 APN 7 144081873 missense probably benign 0.16
R0077:Shank2 UTSW 7 144192467 missense possibly damaging 0.85
R0109:Shank2 UTSW 7 144410577 missense possibly damaging 0.81
R0126:Shank2 UTSW 7 144031355 missense probably damaging 0.99
R0153:Shank2 UTSW 7 144070135 missense probably benign 0.04
R0644:Shank2 UTSW 7 144411849 missense probably benign
R1072:Shank2 UTSW 7 144411568 missense probably damaging 1.00
R1245:Shank2 UTSW 7 144411720 missense probably benign 0.00
R1424:Shank2 UTSW 7 144052372 missense probably damaging 0.99
R1712:Shank2 UTSW 7 144411153 missense probably damaging 1.00
R1739:Shank2 UTSW 7 144179853 missense probably damaging 1.00
R1791:Shank2 UTSW 7 144410599 missense probably damaging 1.00
R1889:Shank2 UTSW 7 144186858 nonsense probably null
R2074:Shank2 UTSW 7 144409540 missense probably damaging 1.00
R2135:Shank2 UTSW 7 144411234 missense probably damaging 0.99
R2355:Shank2 UTSW 7 144057718 missense possibly damaging 0.94
R2511:Shank2 UTSW 7 144411577 missense probably damaging 1.00
R2517:Shank2 UTSW 7 144052305 missense possibly damaging 0.89
R2570:Shank2 UTSW 7 144068770 missense probably damaging 1.00
R2846:Shank2 UTSW 7 144070055 missense probably damaging 1.00
R3159:Shank2 UTSW 7 144081874 missense probably damaging 0.98
R3881:Shank2 UTSW 7 144405384 missense probably benign
R3907:Shank2 UTSW 7 144409576 missense probably damaging 1.00
R3938:Shank2 UTSW 7 144128375 missense probably benign 0.20
R4151:Shank2 UTSW 7 144054828 missense probably damaging 1.00
R4369:Shank2 UTSW 7 144179781 missense probably damaging 0.99
R4372:Shank2 UTSW 7 144410862 missense probably benign 0.09
R4627:Shank2 UTSW 7 144411424 missense probably damaging 1.00
R4645:Shank2 UTSW 7 144410422 missense possibly damaging 0.65
R4647:Shank2 UTSW 7 144411829 missense probably damaging 1.00
R4689:Shank2 UTSW 7 144420605 missense probably benign 0.07
R4751:Shank2 UTSW 7 144409468 missense probably damaging 1.00
R4816:Shank2 UTSW 7 144052306 missense probably damaging 1.00
R4843:Shank2 UTSW 7 144031409 missense probably benign 0.17
R4929:Shank2 UTSW 7 144411271 missense probably benign 0.01
R5009:Shank2 UTSW 7 144070179 missense probably benign 0.00
R5027:Shank2 UTSW 7 144259105 nonsense probably null
R5165:Shank2 UTSW 7 144409636 missense possibly damaging 0.62
R5278:Shank2 UTSW 7 144068875 critical splice donor site probably null
R5332:Shank2 UTSW 7 144411292 missense possibly damaging 0.82
R5497:Shank2 UTSW 7 144409534 missense probably damaging 1.00
R5525:Shank2 UTSW 7 144070109 missense probably damaging 1.00
R5575:Shank2 UTSW 7 144410134 missense probably damaging 1.00
R5948:Shank2 UTSW 7 144407223 missense probably damaging 0.98
R6024:Shank2 UTSW 7 144180031 missense probably benign 0.12
R6306:Shank2 UTSW 7 144409680 missense probably benign 0.00
R6317:Shank2 UTSW 7 144285084 missense possibly damaging 0.89
R6358:Shank2 UTSW 7 144031297 missense probably benign 0.25
R6364:Shank2 UTSW 7 144410409 missense probably benign 0.14
R6413:Shank2 UTSW 7 144410218 missense probably damaging 1.00
R6680:Shank2 UTSW 7 144420866 missense probably damaging 1.00
R6834:Shank2 UTSW 7 144409894 missense probably damaging 1.00
R6870:Shank2 UTSW 7 144052460 missense probably damaging 0.99
R6933:Shank2 UTSW 7 144091778 missense probably benign 0.19
R6983:Shank2 UTSW 7 144081848 missense possibly damaging 0.94
R7082:Shank2 UTSW 7 144410359 missense probably damaging 0.99
R7100:Shank2 UTSW 7 144411164 missense possibly damaging 0.73
R7111:Shank2 UTSW 7 144411552 missense probably benign 0.00
R7213:Shank2 UTSW 7 144031409 missense probably benign 0.17
R7225:Shank2 UTSW 7 144285025 missense probably benign 0.42
R7325:Shank2 UTSW 7 144411685 missense probably benign 0.04
R7605:Shank2 UTSW 7 144091779 missense possibly damaging 0.64
R7909:Shank2 UTSW 7 144411394 missense probably damaging 1.00
R7976:Shank2 UTSW 7 144411061 missense probably damaging 0.99
R8118:Shank2 UTSW 7 144409875 missense probably benign 0.01
RF009:Shank2 UTSW 7 144411571 missense possibly damaging 0.81
Z1176:Shank2 UTSW 7 144128377 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACGTGCTCCATACCCATC -3'
(R):5'- TCACCACCACCTAGGAAGTG -3'

Sequencing Primer
(F):5'- ATCATCGTCAAGGAACCCTC -3'
(R):5'- AGGAAGTGATTCTCCAGCTCC -3'
Posted On2015-08-18