Incidental Mutation 'R4519:Sipa1l2'
ID334124
Institutional Source Beutler Lab
Gene Symbol Sipa1l2
Ensembl Gene ENSMUSG00000001995
Gene Namesignal-induced proliferation-associated 1 like 2
Synonyms
MMRRC Submission 041590-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R4519 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location125418063-125569808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125492226 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 124 (D124G)
Ref Sequence ENSEMBL: ENSMUSP00000148536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]
Predicted Effect probably benign
Transcript: ENSMUST00000108775
AA Change: D124G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: D124G

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
Pfam:Rap_GAP 625 807 2.6e-67 PFAM
PDZ 960 1026 6.47e-9 SMART
low complexity region 1091 1103 N/A INTRINSIC
low complexity region 1120 1138 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
low complexity region 1299 1312 N/A INTRINSIC
low complexity region 1321 1329 N/A INTRINSIC
low complexity region 1334 1355 N/A INTRINSIC
low complexity region 1404 1418 N/A INTRINSIC
Pfam:SPAR_C 1421 1666 2.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212168
AA Change: D124G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000212987
AA Change: D124G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A G 9: 114,300,024 noncoding transcript Het
Acadsb A T 7: 131,430,004 T190S probably damaging Het
Adamts17 G T 7: 66,840,566 G132V probably damaging Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Atp8b4 A T 2: 126,414,459 probably null Het
Btbd18 T C 2: 84,667,580 Y521H probably damaging Het
Casd1 A G 6: 4,621,102 N220S probably benign Het
Ccdc112 T G 18: 46,287,546 E379A possibly damaging Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cntrl A T 2: 35,173,111 K1573M probably damaging Het
Col14a1 A T 15: 55,388,579 I544F unknown Het
Cyp20a1 A T 1: 60,387,147 Y416F probably damaging Het
Dagla T C 19: 10,269,732 K132E probably damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Ddx41 A T 13: 55,533,144 V329E probably damaging Het
Dhx32 A T 7: 133,734,109 Y272N probably damaging Het
Fam114a1 C A 5: 65,005,882 P174Q probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam214a A G 9: 75,023,647 I957M probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Ghr T A 15: 3,333,488 L167F probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm9767 T C 10: 26,078,858 probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Gsdme A T 6: 50,229,353 I170N probably damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Kmt2c T A 5: 25,363,477 K867M probably damaging Het
Krt35 A G 11: 100,094,627 V196A possibly damaging Het
Ltbp1 A T 17: 75,364,497 M1558L probably benign Het
Mcam T G 9: 44,141,343 M623R possibly damaging Het
Mrps26 A T 2: 130,564,349 Q134L probably benign Het
Mxra8 T C 4: 155,842,983 probably null Het
Olfr532 A G 7: 140,419,210 S188P probably damaging Het
Olfr659 G A 7: 104,670,839 G46R probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Parg C A 14: 32,209,635 T404K probably damaging Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Piezo2 T C 18: 63,072,880 E1486G probably damaging Het
Pign A T 1: 105,597,666 probably null Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Ppp6r1 A C 7: 4,641,046 probably null Het
Ptdss2 A G 7: 141,154,578 T309A probably benign Het
Ptprt T C 2: 161,564,689 M987V probably damaging Het
Rgs17 C A 10: 5,918,192 L9F probably benign Het
Rock2 A G 12: 16,977,737 R168G probably damaging Het
Rsph4a T A 10: 33,911,627 L593* probably null Het
Scaf11 C A 15: 96,424,838 K108N probably damaging Het
Sec23b T A 2: 144,582,015 M528K possibly damaging Het
Shank2 G A 7: 144,410,205 D727N probably damaging Het
Spatc1 A T 15: 76,292,485 I479F probably damaging Het
Tmem126b A G 7: 90,469,108 L188P probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Vmn2r62 A G 7: 42,764,533 F829L probably damaging Het
Other mutations in Sipa1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Sipa1l2 APN 8 125491806 missense probably damaging 1.00
IGL00939:Sipa1l2 APN 8 125464435 splice site probably benign
IGL00965:Sipa1l2 APN 8 125447874 missense probably benign 0.02
IGL01321:Sipa1l2 APN 8 125491518 missense probably damaging 1.00
IGL01450:Sipa1l2 APN 8 125422577 critical splice donor site probably null
IGL01753:Sipa1l2 APN 8 125453292 splice site probably benign
IGL01930:Sipa1l2 APN 8 125419239 missense probably damaging 0.99
IGL02041:Sipa1l2 APN 8 125491819 missense probably benign 0.03
IGL02215:Sipa1l2 APN 8 125447837 missense possibly damaging 0.67
IGL02272:Sipa1l2 APN 8 125492011 missense probably damaging 1.00
IGL02370:Sipa1l2 APN 8 125480269 missense probably damaging 1.00
IGL02538:Sipa1l2 APN 8 125451977 missense probably damaging 1.00
IGL02633:Sipa1l2 APN 8 125447768 missense probably damaging 1.00
IGL03394:Sipa1l2 APN 8 125491659 missense possibly damaging 0.67
Rebellious UTSW 8 125468339 missense probably benign 0.01
R0144:Sipa1l2 UTSW 8 125449876 splice site probably null
R0153:Sipa1l2 UTSW 8 125421898 missense probably damaging 0.99
R0276:Sipa1l2 UTSW 8 125421940 missense probably damaging 1.00
R0318:Sipa1l2 UTSW 8 125447697 missense possibly damaging 0.73
R0373:Sipa1l2 UTSW 8 125464410 missense probably damaging 0.99
R0427:Sipa1l2 UTSW 8 125480332 missense probably damaging 1.00
R0634:Sipa1l2 UTSW 8 125422624 nonsense probably null
R1377:Sipa1l2 UTSW 8 125491977 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1435:Sipa1l2 UTSW 8 125468725 missense probably damaging 1.00
R1523:Sipa1l2 UTSW 8 125447613 missense possibly damaging 0.75
R1577:Sipa1l2 UTSW 8 125492262 missense probably benign 0.00
R1581:Sipa1l2 UTSW 8 125491617 missense probably damaging 0.96
R1583:Sipa1l2 UTSW 8 125421895 missense probably damaging 0.97
R1719:Sipa1l2 UTSW 8 125444535 missense probably damaging 0.99
R1730:Sipa1l2 UTSW 8 125480141 splice site probably null
R1940:Sipa1l2 UTSW 8 125480148 splice site probably benign
R2007:Sipa1l2 UTSW 8 125439437 missense probably damaging 1.00
R2141:Sipa1l2 UTSW 8 125491491 missense probably benign 0.07
R2203:Sipa1l2 UTSW 8 125491627 missense probably damaging 0.99
R2764:Sipa1l2 UTSW 8 125492374 missense probably damaging 0.99
R3722:Sipa1l2 UTSW 8 125473584 missense probably damaging 1.00
R3787:Sipa1l2 UTSW 8 125423205 missense probably benign
R3787:Sipa1l2 UTSW 8 125450383 missense possibly damaging 0.52
R4106:Sipa1l2 UTSW 8 125492308 missense probably damaging 1.00
R4117:Sipa1l2 UTSW 8 125468510 missense probably damaging 1.00
R4194:Sipa1l2 UTSW 8 125491672 missense probably benign 0.00
R4237:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4240:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4448:Sipa1l2 UTSW 8 125492355 missense probably damaging 1.00
R4515:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4523:Sipa1l2 UTSW 8 125492424 missense probably damaging 1.00
R4557:Sipa1l2 UTSW 8 125464415 missense probably damaging 0.98
R4667:Sipa1l2 UTSW 8 125453470 missense possibly damaging 0.93
R4687:Sipa1l2 UTSW 8 125491245 missense probably damaging 1.00
R4854:Sipa1l2 UTSW 8 125473601 missense probably damaging 1.00
R4890:Sipa1l2 UTSW 8 125491867 missense probably damaging 1.00
R5065:Sipa1l2 UTSW 8 125491585 missense probably benign 0.19
R5194:Sipa1l2 UTSW 8 125439273 missense possibly damaging 0.48
R5266:Sipa1l2 UTSW 8 125492126 missense probably damaging 0.99
R5475:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R5718:Sipa1l2 UTSW 8 125491248 missense probably damaging 1.00
R5910:Sipa1l2 UTSW 8 125491684 missense probably benign 0.42
R5916:Sipa1l2 UTSW 8 125468573 missense probably damaging 1.00
R5941:Sipa1l2 UTSW 8 125473536 missense probably damaging 0.99
R6083:Sipa1l2 UTSW 8 125468473 missense possibly damaging 0.87
R6185:Sipa1l2 UTSW 8 125468253 nonsense probably null
R6235:Sipa1l2 UTSW 8 125474871 missense probably damaging 1.00
R6274:Sipa1l2 UTSW 8 125469872 missense probably damaging 1.00
R6299:Sipa1l2 UTSW 8 125453464 missense possibly damaging 0.75
R6374:Sipa1l2 UTSW 8 125444630 missense probably damaging 1.00
R6459:Sipa1l2 UTSW 8 125444484 critical splice donor site probably null
R6462:Sipa1l2 UTSW 8 125491230 missense probably damaging 1.00
R6496:Sipa1l2 UTSW 8 125449894 missense probably benign 0.00
R6543:Sipa1l2 UTSW 8 125450362 missense possibly damaging 0.50
R7154:Sipa1l2 UTSW 8 125468339 missense probably benign 0.01
R7192:Sipa1l2 UTSW 8 125422609 missense probably benign 0.09
R7240:Sipa1l2 UTSW 8 125469860 missense probably damaging 1.00
R7361:Sipa1l2 UTSW 8 125453332 missense probably damaging 1.00
R7383:Sipa1l2 UTSW 8 125447646 missense probably damaging 1.00
R7417:Sipa1l2 UTSW 8 125482106 missense possibly damaging 0.93
R7604:Sipa1l2 UTSW 8 125419272 missense probably benign 0.45
R7658:Sipa1l2 UTSW 8 125492290 missense probably benign 0.00
R7743:Sipa1l2 UTSW 8 125464233 missense probably damaging 1.00
R7781:Sipa1l2 UTSW 8 125491827 missense possibly damaging 0.46
R7812:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R7829:Sipa1l2 UTSW 8 125451988 missense probably damaging 1.00
R7880:Sipa1l2 UTSW 8 125464393 missense probably damaging 1.00
R7884:Sipa1l2 UTSW 8 125447598 missense probably benign
R8057:Sipa1l2 UTSW 8 125468530 missense probably damaging 1.00
R8082:Sipa1l2 UTSW 8 125491809 missense possibly damaging 0.82
R8092:Sipa1l2 UTSW 8 125419168 missense probably benign 0.03
R8247:Sipa1l2 UTSW 8 125422633 missense probably benign 0.29
R8252:Sipa1l2 UTSW 8 125468671 missense probably damaging 1.00
R8386:Sipa1l2 UTSW 8 125492093 missense probably damaging 1.00
X0027:Sipa1l2 UTSW 8 125492136 missense probably damaging 1.00
Z1177:Sipa1l2 UTSW 8 125447556 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AAGTGCTCCCATACTCCCTG -3'
(R):5'- ACACTTCCAGTTCGAGTGAGG -3'

Sequencing Primer
(F):5'- GCTCCCATACTCCCTGTGCAG -3'
(R):5'- CAGTTCGAGTGAGGGCGGAG -3'
Posted On2015-08-18