Incidental Mutation 'R4519:Mcam'
ID334125
Institutional Source Beutler Lab
Gene Symbol Mcam
Ensembl Gene ENSMUSG00000032135
Gene Namemelanoma cell adhesion molecule
SynonymsMuc18, CD146, s-gicerin, 1-gicerin, s-endo
MMRRC Submission 041590-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R4519 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44134469-44142727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 44141343 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 623 (M623R)
Ref Sequence ENSEMBL: ENSMUSP00000034650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034650] [ENSMUST00000098852] [ENSMUST00000147836] [ENSMUST00000149241] [ENSMUST00000206147] [ENSMUST00000206720] [ENSMUST00000216002]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034650
AA Change: M623R

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034650
Gene: ENSMUSG00000032135
AA Change: M623R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 35 135 6.61e-4 SMART
IG_like 155 213 4.22e-1 SMART
IG 259 343 8.13e-4 SMART
IGc2 358 416 3.4e-6 SMART
IG_like 445 508 1.92e0 SMART
low complexity region 511 525 N/A INTRINSIC
transmembrane domain 562 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098852
SMART Domains Protein: ENSMUSP00000096451
Gene: ENSMUSG00000032135

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 35 135 6.61e-4 SMART
IG_like 155 213 4.22e-1 SMART
IG 259 343 8.13e-4 SMART
IGc2 358 416 3.4e-6 SMART
IG_like 445 508 1.92e0 SMART
low complexity region 511 525 N/A INTRINSIC
transmembrane domain 562 584 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132490
Predicted Effect probably benign
Transcript: ENSMUST00000147836
SMART Domains Protein: ENSMUSP00000117924
Gene: ENSMUSG00000032135

DomainStartEndE-ValueType
Pfam:V-set 2 97 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149241
SMART Domains Protein: ENSMUSP00000121090
Gene: ENSMUSG00000032135

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 64 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206163
Predicted Effect probably benign
Transcript: ENSMUST00000206720
Predicted Effect probably benign
Transcript: ENSMUST00000216002
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in endothelial cells exhibit impaired VEGF-induced angiogenesis in Matrigel. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A G 9: 114,300,024 noncoding transcript Het
Acadsb A T 7: 131,430,004 T190S probably damaging Het
Adamts17 G T 7: 66,840,566 G132V probably damaging Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Atp8b4 A T 2: 126,414,459 probably null Het
Btbd18 T C 2: 84,667,580 Y521H probably damaging Het
Casd1 A G 6: 4,621,102 N220S probably benign Het
Ccdc112 T G 18: 46,287,546 E379A possibly damaging Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cntrl A T 2: 35,173,111 K1573M probably damaging Het
Col14a1 A T 15: 55,388,579 I544F unknown Het
Cyp20a1 A T 1: 60,387,147 Y416F probably damaging Het
Dagla T C 19: 10,269,732 K132E probably damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Ddx41 A T 13: 55,533,144 V329E probably damaging Het
Dhx32 A T 7: 133,734,109 Y272N probably damaging Het
Fam114a1 C A 5: 65,005,882 P174Q probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam214a A G 9: 75,023,647 I957M probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Ghr T A 15: 3,333,488 L167F probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm9767 T C 10: 26,078,858 probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Gsdme A T 6: 50,229,353 I170N probably damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Kmt2c T A 5: 25,363,477 K867M probably damaging Het
Krt35 A G 11: 100,094,627 V196A possibly damaging Het
Ltbp1 A T 17: 75,364,497 M1558L probably benign Het
Mrps26 A T 2: 130,564,349 Q134L probably benign Het
Mxra8 T C 4: 155,842,983 probably null Het
Olfr532 A G 7: 140,419,210 S188P probably damaging Het
Olfr659 G A 7: 104,670,839 G46R probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Parg C A 14: 32,209,635 T404K probably damaging Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Piezo2 T C 18: 63,072,880 E1486G probably damaging Het
Pign A T 1: 105,597,666 probably null Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Ppp6r1 A C 7: 4,641,046 probably null Het
Ptdss2 A G 7: 141,154,578 T309A probably benign Het
Ptprt T C 2: 161,564,689 M987V probably damaging Het
Rgs17 C A 10: 5,918,192 L9F probably benign Het
Rock2 A G 12: 16,977,737 R168G probably damaging Het
Rsph4a T A 10: 33,911,627 L593* probably null Het
Scaf11 C A 15: 96,424,838 K108N probably damaging Het
Sec23b T A 2: 144,582,015 M528K possibly damaging Het
Shank2 G A 7: 144,410,205 D727N probably damaging Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Spatc1 A T 15: 76,292,485 I479F probably damaging Het
Tmem126b A G 7: 90,469,108 L188P probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Vmn2r62 A G 7: 42,764,533 F829L probably damaging Het
Other mutations in Mcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02408:Mcam APN 9 44140250 missense probably benign 0.01
IGL02671:Mcam APN 9 44137034 splice site probably benign
IGL02682:Mcam APN 9 44140417 missense possibly damaging 0.80
IGL03384:Mcam APN 9 44140512 unclassified probably benign
R0238:Mcam UTSW 9 44140205 unclassified probably null
R0238:Mcam UTSW 9 44140205 unclassified probably null
R0320:Mcam UTSW 9 44140186 missense possibly damaging 0.89
R1432:Mcam UTSW 9 44141291 missense probably damaging 0.98
R1485:Mcam UTSW 9 44136763 missense probably damaging 1.00
R1503:Mcam UTSW 9 44141291 missense probably damaging 0.98
R1730:Mcam UTSW 9 44134706 missense probably damaging 1.00
R1783:Mcam UTSW 9 44134706 missense probably damaging 1.00
R2146:Mcam UTSW 9 44136635 missense probably damaging 0.99
R2150:Mcam UTSW 9 44136635 missense probably damaging 0.99
R2215:Mcam UTSW 9 44139953 nonsense probably null
R4366:Mcam UTSW 9 44134697 missense probably damaging 1.00
R4948:Mcam UTSW 9 44136566 missense probably damaging 1.00
R5965:Mcam UTSW 9 44136628 missense probably damaging 1.00
R6704:Mcam UTSW 9 44136920 missense probably benign 0.06
R6955:Mcam UTSW 9 44139269 missense probably damaging 1.00
R7273:Mcam UTSW 9 44140944 missense possibly damaging 0.78
R7529:Mcam UTSW 9 44138895 missense probably benign 0.08
R7623:Mcam UTSW 9 44139658 missense probably benign 0.28
R7659:Mcam UTSW 9 44136770 missense unknown
R8066:Mcam UTSW 9 44140960 missense probably damaging 1.00
Z1177:Mcam UTSW 9 44134590 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGTCCACTACCAAACTGCC -3'
(R):5'- AAGGCAAGAGAGGTCTGCTC -3'

Sequencing Primer
(F):5'- AATTCTCCCTTCCTGAGCCGG -3'
(R):5'- AAGAGAGGTCTGCTCCCCATC -3'
Posted On2015-08-18