Incidental Mutation 'R4519:Golga4'
ID 334129
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Name golgin A4
Synonyms golgin-245, Olp-1
MMRRC Submission 041590-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4519 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 118335335-118411587 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118388076 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1733 (S1733T)
Ref Sequence ENSEMBL: ENSMUSP00000081880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]
AlphaFold Q91VW5
Predicted Effect probably benign
Transcript: ENSMUST00000084820
AA Change: S1733T

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: S1733T

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000211840
AA Change: S743T
Predicted Effect probably benign
Transcript: ENSMUST00000212097
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect probably benign
Transcript: ENSMUST00000212274
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A G 9: 114,129,092 (GRCm39) noncoding transcript Het
Acadsb A T 7: 131,031,733 (GRCm39) T190S probably damaging Het
Adamts17 G T 7: 66,490,314 (GRCm39) G132V probably damaging Het
Atosa A G 9: 74,930,929 (GRCm39) I957M probably damaging Het
Atp8b3 C T 10: 80,359,681 (GRCm39) M984I probably benign Het
Atp8b4 A T 2: 126,256,379 (GRCm39) probably null Het
Btbd18 T C 2: 84,497,924 (GRCm39) Y521H probably damaging Het
Casd1 A G 6: 4,621,102 (GRCm39) N220S probably benign Het
Ccdc112 T G 18: 46,420,613 (GRCm39) E379A possibly damaging Het
Ccdc88a T C 11: 29,432,651 (GRCm39) I1219T probably benign Het
Cntrl A T 2: 35,063,123 (GRCm39) K1573M probably damaging Het
Col14a1 A T 15: 55,251,975 (GRCm39) I544F unknown Het
Cyp20a1 A T 1: 60,426,306 (GRCm39) Y416F probably damaging Het
Dagla T C 19: 10,247,096 (GRCm39) K132E probably damaging Het
Dbn1 A T 13: 55,624,042 (GRCm39) I350N possibly damaging Het
Ddx41 A T 13: 55,680,957 (GRCm39) V329E probably damaging Het
Dhx32 A T 7: 133,335,838 (GRCm39) Y272N probably damaging Het
Fam114a1 C A 5: 65,163,225 (GRCm39) P174Q probably benign Het
Galnt3 C A 2: 65,923,954 (GRCm39) R438L probably damaging Het
Ghr T A 15: 3,362,970 (GRCm39) L167F probably damaging Het
Glod4 T A 11: 76,134,397 (GRCm39) D25V probably damaging Het
Gm9767 T C 10: 25,954,756 (GRCm39) probably benign Het
Gsdme A T 6: 50,206,333 (GRCm39) I170N probably damaging Het
H2-M10.3 C T 17: 36,678,722 (GRCm39) probably null Het
Kmt2c T A 5: 25,568,475 (GRCm39) K867M probably damaging Het
Krt35 A G 11: 99,985,453 (GRCm39) V196A possibly damaging Het
Ltbp1 A T 17: 75,671,492 (GRCm39) M1558L probably benign Het
Mcam T G 9: 44,052,640 (GRCm39) M623R possibly damaging Het
Mrps26 A T 2: 130,406,269 (GRCm39) Q134L probably benign Het
Mxra8 T C 4: 155,927,440 (GRCm39) probably null Het
Or13a21 A G 7: 139,999,123 (GRCm39) S188P probably damaging Het
Or52n20 G A 7: 104,320,046 (GRCm39) G46R probably damaging Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Parg C A 14: 31,931,592 (GRCm39) T404K probably damaging Het
Parp8 C A 13: 117,032,209 (GRCm39) L321F possibly damaging Het
Piezo2 T C 18: 63,205,951 (GRCm39) E1486G probably damaging Het
Pign A T 1: 105,525,391 (GRCm39) probably null Het
Pik3r4 A G 9: 105,549,924 (GRCm39) H1005R probably damaging Het
Ppp6r1 A C 7: 4,644,045 (GRCm39) probably null Het
Ptdss2 A G 7: 140,734,491 (GRCm39) T309A probably benign Het
Ptprt T C 2: 161,406,609 (GRCm39) M987V probably damaging Het
Rgs17 C A 10: 5,868,192 (GRCm39) L9F probably benign Het
Rock2 A G 12: 17,027,738 (GRCm39) R168G probably damaging Het
Rsph4a T A 10: 33,787,623 (GRCm39) L593* probably null Het
Scaf11 C A 15: 96,322,719 (GRCm39) K108N probably damaging Het
Sec23b T A 2: 144,423,935 (GRCm39) M528K possibly damaging Het
Shank2 G A 7: 143,963,942 (GRCm39) D727N probably damaging Het
Sipa1l2 T C 8: 126,218,965 (GRCm39) D124G probably benign Het
Spatc1 A T 15: 76,176,685 (GRCm39) I479F probably damaging Het
Tmem126b A G 7: 90,118,316 (GRCm39) L188P probably damaging Het
Tnrc6b T G 15: 80,764,448 (GRCm39) L650W probably damaging Het
Vmn2r62 A G 7: 42,413,957 (GRCm39) F829L probably damaging Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118,343,339 (GRCm39) critical splice donor site probably null
IGL00801:Golga4 APN 9 118,367,994 (GRCm39) missense probably damaging 0.98
IGL01395:Golga4 APN 9 118,364,441 (GRCm39) missense probably damaging 1.00
IGL01472:Golga4 APN 9 118,361,642 (GRCm39) missense probably damaging 1.00
IGL01519:Golga4 APN 9 118,356,160 (GRCm39) missense probably damaging 1.00
IGL01563:Golga4 APN 9 118,356,074 (GRCm39) splice site probably benign
IGL02593:Golga4 APN 9 118,384,634 (GRCm39) unclassified probably benign
IGL02803:Golga4 APN 9 118,364,528 (GRCm39) missense probably benign
IGL02939:Golga4 APN 9 118,363,700 (GRCm39) missense probably damaging 1.00
IGL02939:Golga4 APN 9 118,364,522 (GRCm39) missense probably benign 0.01
IGL03123:Golga4 APN 9 118,365,953 (GRCm39) missense probably damaging 1.00
IGL03334:Golga4 APN 9 118,366,301 (GRCm39) splice site probably benign
F5770:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118,382,525 (GRCm39) missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118,382,521 (GRCm39) missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118,389,808 (GRCm39) critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118,398,061 (GRCm39) missense probably benign 0.00
R0362:Golga4 UTSW 9 118,384,853 (GRCm39) missense probably benign 0.13
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0974:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R1128:Golga4 UTSW 9 118,377,852 (GRCm39) missense probably benign 0.40
R1384:Golga4 UTSW 9 118,394,719 (GRCm39) missense probably damaging 0.99
R1435:Golga4 UTSW 9 118,364,508 (GRCm39) missense probably benign 0.00
R1513:Golga4 UTSW 9 118,384,800 (GRCm39) missense probably benign 0.02
R1818:Golga4 UTSW 9 118,402,055 (GRCm39) missense probably damaging 1.00
R2083:Golga4 UTSW 9 118,361,658 (GRCm39) missense probably damaging 1.00
R2243:Golga4 UTSW 9 118,385,972 (GRCm39) missense probably benign 0.06
R2355:Golga4 UTSW 9 118,389,810 (GRCm39) missense probably benign 0.00
R2518:Golga4 UTSW 9 118,385,680 (GRCm39) missense probably damaging 1.00
R2921:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118,386,448 (GRCm39) missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118,363,715 (GRCm39) missense probably benign 0.16
R3909:Golga4 UTSW 9 118,387,804 (GRCm39) missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118,368,039 (GRCm39) missense probably damaging 0.99
R4321:Golga4 UTSW 9 118,385,503 (GRCm39) missense probably damaging 1.00
R4358:Golga4 UTSW 9 118,380,946 (GRCm39) missense probably benign 0.16
R4483:Golga4 UTSW 9 118,343,254 (GRCm39) missense probably damaging 1.00
R4515:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4518:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4545:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4546:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4580:Golga4 UTSW 9 118,386,327 (GRCm39) missense probably benign 0.00
R4918:Golga4 UTSW 9 118,387,213 (GRCm39) missense probably damaging 1.00
R5007:Golga4 UTSW 9 118,387,368 (GRCm39) missense probably benign
R5045:Golga4 UTSW 9 118,394,724 (GRCm39) missense probably benign
R5232:Golga4 UTSW 9 118,335,626 (GRCm39) critical splice donor site probably null
R5256:Golga4 UTSW 9 118,385,569 (GRCm39) missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118,388,125 (GRCm39) nonsense probably null
R5567:Golga4 UTSW 9 118,387,251 (GRCm39) missense probably damaging 1.00
R5576:Golga4 UTSW 9 118,382,602 (GRCm39) missense probably benign 0.13
R5771:Golga4 UTSW 9 118,387,351 (GRCm39) missense probably damaging 0.96
R5807:Golga4 UTSW 9 118,356,198 (GRCm39) missense probably damaging 0.99
R5860:Golga4 UTSW 9 118,387,174 (GRCm39) missense probably damaging 1.00
R6012:Golga4 UTSW 9 118,388,764 (GRCm39) missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118,387,695 (GRCm39) nonsense probably null
R6299:Golga4 UTSW 9 118,386,438 (GRCm39) missense probably benign 0.03
R6467:Golga4 UTSW 9 118,365,860 (GRCm39) missense probably damaging 1.00
R6552:Golga4 UTSW 9 118,343,299 (GRCm39) missense probably damaging 1.00
R6688:Golga4 UTSW 9 118,343,278 (GRCm39) missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118,377,847 (GRCm39) missense probably damaging 1.00
R6987:Golga4 UTSW 9 118,387,600 (GRCm39) missense probably benign
R7212:Golga4 UTSW 9 118,365,908 (GRCm39) missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118,388,563 (GRCm39) missense probably benign
R7431:Golga4 UTSW 9 118,388,799 (GRCm39) missense probably damaging 1.00
R7641:Golga4 UTSW 9 118,386,643 (GRCm39) missense probably benign 0.05
R7727:Golga4 UTSW 9 118,377,770 (GRCm39) missense probably damaging 1.00
R7729:Golga4 UTSW 9 118,385,131 (GRCm39) missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118,361,643 (GRCm39) missense probably damaging 1.00
R7849:Golga4 UTSW 9 118,388,379 (GRCm39) missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118,385,434 (GRCm39) missense probably damaging 1.00
R7976:Golga4 UTSW 9 118,365,836 (GRCm39) missense possibly damaging 0.49
R8275:Golga4 UTSW 9 118,361,627 (GRCm39) missense probably damaging 1.00
R8378:Golga4 UTSW 9 118,387,390 (GRCm39) missense probably benign 0.03
R8514:Golga4 UTSW 9 118,384,864 (GRCm39) missense possibly damaging 0.47
R8698:Golga4 UTSW 9 118,385,029 (GRCm39) missense probably damaging 0.97
R8856:Golga4 UTSW 9 118,385,779 (GRCm39) missense probably damaging 0.98
R9227:Golga4 UTSW 9 118,385,941 (GRCm39) missense possibly damaging 0.94
R9282:Golga4 UTSW 9 118,385,893 (GRCm39) missense probably damaging 1.00
RF022:Golga4 UTSW 9 118,387,057 (GRCm39) missense probably damaging 1.00
V7583:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GAAGCAGCTCTTGTCTCAGATG -3'
(R):5'- CCTGGCTCTAGTGCAGTCTAAC -3'

Sequencing Primer
(F):5'- CAGCTCTTGTCTCAGATGGAAGAG -3'
(R):5'- GTGCAGTCTAACTTTCCAGAGAGC -3'
Posted On 2015-08-18