Incidental Mutation 'R0207:Usp43'
Institutional Source Beutler Lab
Gene Symbol Usp43
Ensembl Gene ENSMUSG00000020905
Gene Nameubiquitin specific peptidase 43
MMRRC Submission 038460-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0207 (G1)
Quality Score225
Status Validated
Chromosomal Location67854523-67922153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67876499 bp
Amino Acid Change Tyrosine to Histidine at position 682 (Y682H)
Ref Sequence ENSEMBL: ENSMUSP00000021288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021288] [ENSMUST00000108677]
Predicted Effect probably damaging
Transcript: ENSMUST00000021288
AA Change: Y682H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021288
Gene: ENSMUSG00000020905
AA Change: Y682H

low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 707 2.8e-61 PFAM
Pfam:UCH_1 101 297 1.3e-6 PFAM
Pfam:UCH_1 503 689 5.2e-13 PFAM
low complexity region 717 731 N/A INTRINSIC
low complexity region 958 972 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108677
AA Change: Y677H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104317
Gene: ENSMUSG00000020905
AA Change: Y677H

low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 702 3.5e-54 PFAM
Pfam:UCH_1 101 298 2.7e-7 PFAM
Pfam:UCH_1 503 684 1.2e-9 PFAM
low complexity region 712 726 N/A INTRINSIC
low complexity region 953 967 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129961
Meta Mutation Damage Score 0.7656 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 95% (76/80)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,086,039 F488S probably damaging Het
Acap3 C T 4: 155,899,424 R116W probably damaging Het
Adamts10 C A 17: 33,545,390 P663T possibly damaging Het
Akap12 G A 10: 4,353,333 G48S probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Ankzf1 C A 1: 75,198,304 D599E possibly damaging Het
Aox1 T C 1: 58,105,014 I1278T possibly damaging Het
Apcdd1 T C 18: 62,950,079 Y327H probably benign Het
Asxl3 T A 18: 22,411,496 probably benign Het
Birc6 C A 17: 74,662,832 probably benign Het
Btaf1 T A 19: 37,009,648 L1714* probably null Het
Cacng6 T A 7: 3,425,004 probably benign Het
Cdc20b A G 13: 113,078,612 D238G probably damaging Het
Celf5 T A 10: 81,470,698 R113W probably null Het
Cfap70 C A 14: 20,412,347 E659D probably damaging Het
Clspn T A 4: 126,590,598 M1183K possibly damaging Het
Dpy19l1 G A 9: 24,453,891 R275C probably damaging Het
Dst C T 1: 34,186,935 S1721L probably benign Het
Faap100 T C 11: 120,374,365 T562A probably damaging Het
Fam168b T C 1: 34,819,688 M133V probably damaging Het
Farp2 T C 1: 93,569,087 I172T probably damaging Het
Fer T G 17: 63,896,278 S68A probably damaging Het
Fmo5 A G 3: 97,645,681 E315G probably damaging Het
Gpr89 A T 3: 96,871,480 F426I probably damaging Het
Hinfp T C 9: 44,296,327 I461V possibly damaging Het
Hsd11b1 A T 1: 193,240,248 V167D probably damaging Het
Htt A G 5: 34,896,908 K2574E probably benign Het
I830077J02Rik A G 3: 105,926,505 S112P probably benign Het
Igf2bp3 T A 6: 49,105,617 M344L probably benign Het
Itch A T 2: 155,202,257 Q494L probably benign Het
Itga9 T C 9: 118,769,253 probably benign Het
Jaml T A 9: 45,093,767 D152E probably benign Het
Kif22 A C 7: 127,042,400 M1R probably null Het
Kifap3 T C 1: 163,883,386 Y663H probably benign Het
Letm2 T A 8: 25,578,770 N472I probably damaging Het
Mthfr T G 4: 148,052,224 V446G probably damaging Het
Myh11 T C 16: 14,211,260 E1206G possibly damaging Het
Myo6 G A 9: 80,288,056 V903I probably damaging Het
Myo9b C T 8: 71,355,225 probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Nsd3 A G 8: 25,683,257 N859S probably benign Het
Nucb2 C A 7: 116,536,010 A384E probably damaging Het
Ogdhl C A 14: 32,342,037 probably null Het
Olfr119 C A 17: 37,701,058 C129* probably null Het
Olfr1247 G A 2: 89,609,863 L80F probably damaging Het
Olfr1357 T C 10: 78,611,871 T257A probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr381 A T 11: 73,486,575 L83Q probably benign Het
Parp10 C T 15: 76,242,633 S145N probably benign Het
Pigh A G 12: 79,083,709 probably benign Het
Pigo A G 4: 43,023,824 probably benign Het
Pkp4 T A 2: 59,305,488 V199D possibly damaging Het
Polr1e C A 4: 45,025,143 probably null Het
Ppfia3 C A 7: 45,348,534 R723L probably damaging Het
Prex1 C A 2: 166,585,898 A945S possibly damaging Het
Prrt3 A T 6: 113,495,840 V457E probably damaging Het
Rab39 A G 9: 53,705,971 F49L possibly damaging Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Rrs1 C A 1: 9,545,762 probably null Het
Serpinb3c T C 1: 107,276,992 D8G probably benign Het
Slc17a6 A G 7: 51,646,180 probably benign Het
Slc24a4 T A 12: 102,228,951 probably null Het
Smc1b C T 15: 85,123,759 M272I probably benign Het
Smc6 T C 12: 11,283,178 probably benign Het
Tcf20 T C 15: 82,855,085 T722A probably benign Het
Tesmin A T 19: 3,404,088 M141L probably benign Het
Tmprss5 T A 9: 49,113,160 H274Q possibly damaging Het
Tns1 C T 1: 73,937,318 probably null Het
Tpr T C 1: 150,417,427 S868P possibly damaging Het
Trank1 C T 9: 111,366,253 T1115I probably damaging Het
Trmt44 A T 5: 35,572,917 I203K possibly damaging Het
Ulk2 A T 11: 61,777,785 V1037E probably benign Het
Vipr2 A T 12: 116,142,882 Q366L probably damaging Het
Vmn1r185 C A 7: 26,611,589 V164L possibly damaging Het
Vmn2r120 C T 17: 57,525,052 V246I probably benign Het
Wdr66 T C 5: 123,283,447 V182A probably damaging Het
Wiz C T 17: 32,357,033 G790R probably damaging Het
Wnk1 A T 6: 119,952,733 S1016R probably damaging Het
Zc3hav1 A G 6: 38,311,174 L909S probably benign Het
Zfp236 T A 18: 82,640,227 I637F probably damaging Het
Zfp788 G A 7: 41,649,596 G532D probably damaging Het
Zranb1 T C 7: 132,950,385 I255T probably damaging Het
Other mutations in Usp43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Usp43 APN 11 67891419 missense probably benign 0.08
IGL01536:Usp43 APN 11 67855938 missense probably benign 0.01
IGL01754:Usp43 APN 11 67856181 missense probably benign 0.06
IGL02057:Usp43 APN 11 67856287 missense probably benign 0.02
IGL02638:Usp43 APN 11 67855755 missense probably benign 0.06
IGL03105:Usp43 APN 11 67879976 missense possibly damaging 0.82
IGL03155:Usp43 APN 11 67876489 missense probably damaging 1.00
IGL03380:Usp43 APN 11 67875316 missense possibly damaging 0.67
R0308:Usp43 UTSW 11 67880140 missense probably damaging 1.00
R0350:Usp43 UTSW 11 67876498 missense probably damaging 1.00
R0479:Usp43 UTSW 11 67897274 missense possibly damaging 0.96
R1451:Usp43 UTSW 11 67856181 missense probably benign 0.01
R1686:Usp43 UTSW 11 67887767 missense probably damaging 0.99
R1750:Usp43 UTSW 11 67879953 missense probably damaging 1.00
R1956:Usp43 UTSW 11 67904333 missense probably damaging 1.00
R2107:Usp43 UTSW 11 67855740 frame shift probably null
R2108:Usp43 UTSW 11 67855740 frame shift probably null
R2112:Usp43 UTSW 11 67921710 missense probably damaging 1.00
R2162:Usp43 UTSW 11 67879969 missense probably damaging 1.00
R2336:Usp43 UTSW 11 67891432 nonsense probably null
R4031:Usp43 UTSW 11 67913833 missense probably damaging 1.00
R4355:Usp43 UTSW 11 67891464 missense probably benign 0.01
R4410:Usp43 UTSW 11 67855890 missense probably benign 0.00
R4479:Usp43 UTSW 11 67856407 missense possibly damaging 0.96
R4569:Usp43 UTSW 11 67875352 nonsense probably null
R4569:Usp43 UTSW 11 67898962 missense probably damaging 1.00
R4737:Usp43 UTSW 11 67855505 missense probably damaging 1.00
R5395:Usp43 UTSW 11 67897358 critical splice acceptor site probably null
R5466:Usp43 UTSW 11 67913883 missense probably damaging 0.99
R5686:Usp43 UTSW 11 67921916 unclassified probably benign
R6106:Usp43 UTSW 11 67879907 missense probably benign 0.00
R7205:Usp43 UTSW 11 67883284 missense probably null 1.00
R7360:Usp43 UTSW 11 67876329 splice site probably null
R7426:Usp43 UTSW 11 67893016 missense possibly damaging 0.60
R7755:Usp43 UTSW 11 67891468 missense possibly damaging 0.94
R7937:Usp43 UTSW 11 67855789 missense probably damaging 0.96
R8054:Usp43 UTSW 11 67891458 missense probably damaging 0.96
R8410:Usp43 UTSW 11 67856320 missense probably damaging 1.00
R8792:Usp43 UTSW 11 67876418 nonsense probably null
R8865:Usp43 UTSW 11 67898962 missense probably damaging 1.00
Z1088:Usp43 UTSW 11 67856040 missense probably benign 0.39
Z1176:Usp43 UTSW 11 67921841 missense unknown
Z1177:Usp43 UTSW 11 67855808 missense possibly damaging 0.56
Z1177:Usp43 UTSW 11 67922032 missense unknown
Z1186:Usp43 UTSW 11 67855719 small insertion probably benign
Z1186:Usp43 UTSW 11 67856506 missense probably benign 0.41
Z1187:Usp43 UTSW 11 67855719 small insertion probably benign
Z1187:Usp43 UTSW 11 67856506 missense probably benign 0.41
Z1188:Usp43 UTSW 11 67855719 small insertion probably benign
Z1188:Usp43 UTSW 11 67856506 missense probably benign 0.41
Z1189:Usp43 UTSW 11 67855719 small insertion probably benign
Z1189:Usp43 UTSW 11 67856506 missense probably benign 0.41
Z1190:Usp43 UTSW 11 67855719 small insertion probably benign
Z1190:Usp43 UTSW 11 67855723 small insertion probably benign
Z1190:Usp43 UTSW 11 67856506 missense probably benign 0.41
Z1191:Usp43 UTSW 11 67855719 small insertion probably benign
Z1191:Usp43 UTSW 11 67856506 missense probably benign 0.41
Z1192:Usp43 UTSW 11 67855719 small insertion probably benign
Z1192:Usp43 UTSW 11 67856506 missense probably benign 0.41
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gtgcggaggtcaaagaaaac -3'
Posted On2013-05-09