Incidental Mutation 'R4519:Spatc1'
ID334144
Institutional Source Beutler Lab
Gene Symbol Spatc1
Ensembl Gene ENSMUSG00000049653
Gene Namespermatogenesis and centriole associated 1
Synonymssperiolin, 1700084J23Rik
MMRRC Submission 041590-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4519 (G1)
Quality Score217
Status Not validated
Chromosome15
Chromosomal Location76268089-76292572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76292485 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 479 (I479F)
Ref Sequence ENSEMBL: ENSMUSP00000073805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023222] [ENSMUST00000074173] [ENSMUST00000163991] [ENSMUST00000171192] [ENSMUST00000171340] [ENSMUST00000230221]
Predicted Effect probably benign
Transcript: ENSMUST00000023222
SMART Domains Protein: ENSMUSP00000023222
Gene: ENSMUSG00000022562

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 212 1.5e-63 PFAM
Pfam:Hydantoinase_A 231 531 6.4e-109 PFAM
low complexity region 629 637 N/A INTRINSIC
Pfam:Hydantoinase_B 734 1256 5.2e-225 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000074173
AA Change: I479F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073805
Gene: ENSMUSG00000049653
AA Change: I479F

DomainStartEndE-ValueType
Pfam:Speriolin_N 1 176 5.1e-67 PFAM
Pfam:Speriolin_N 172 262 1.2e-25 PFAM
Pfam:Speriolin_C 334 480 1.5e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096370
Predicted Effect probably benign
Transcript: ENSMUST00000163991
SMART Domains Protein: ENSMUSP00000134687
Gene: ENSMUSG00000071724

DomainStartEndE-ValueType
transmembrane domain 77 99 N/A INTRINSIC
Pfam:Exo_endo_phos 176 471 4.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170261
Predicted Effect probably benign
Transcript: ENSMUST00000171192
SMART Domains Protein: ENSMUSP00000133693
Gene: ENSMUSG00000071724

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171340
SMART Domains Protein: ENSMUSP00000129100
Gene: ENSMUSG00000022562

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 212 2.8e-60 PFAM
Pfam:Hydantoinase_A 231 531 6.6e-102 PFAM
low complexity region 629 637 N/A INTRINSIC
Pfam:Hydantoinase_B 733 1260 8.2e-190 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175428
Predicted Effect probably benign
Transcript: ENSMUST00000230221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230735
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A G 9: 114,300,024 noncoding transcript Het
Acadsb A T 7: 131,430,004 T190S probably damaging Het
Adamts17 G T 7: 66,840,566 G132V probably damaging Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Atp8b4 A T 2: 126,414,459 probably null Het
Btbd18 T C 2: 84,667,580 Y521H probably damaging Het
Casd1 A G 6: 4,621,102 N220S probably benign Het
Ccdc112 T G 18: 46,287,546 E379A possibly damaging Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cntrl A T 2: 35,173,111 K1573M probably damaging Het
Col14a1 A T 15: 55,388,579 I544F unknown Het
Cyp20a1 A T 1: 60,387,147 Y416F probably damaging Het
Dagla T C 19: 10,269,732 K132E probably damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Ddx41 A T 13: 55,533,144 V329E probably damaging Het
Dhx32 A T 7: 133,734,109 Y272N probably damaging Het
Fam114a1 C A 5: 65,005,882 P174Q probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam214a A G 9: 75,023,647 I957M probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Ghr T A 15: 3,333,488 L167F probably damaging Het
Glod4 T A 11: 76,243,571 D25V probably damaging Het
Gm9767 T C 10: 26,078,858 probably benign Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Gsdme A T 6: 50,229,353 I170N probably damaging Het
H2-M10.3 C T 17: 36,367,830 probably null Het
Kmt2c T A 5: 25,363,477 K867M probably damaging Het
Krt35 A G 11: 100,094,627 V196A possibly damaging Het
Ltbp1 A T 17: 75,364,497 M1558L probably benign Het
Mcam T G 9: 44,141,343 M623R possibly damaging Het
Mrps26 A T 2: 130,564,349 Q134L probably benign Het
Mxra8 T C 4: 155,842,983 probably null Het
Olfr532 A G 7: 140,419,210 S188P probably damaging Het
Olfr659 G A 7: 104,670,839 G46R probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Parg C A 14: 32,209,635 T404K probably damaging Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Piezo2 T C 18: 63,072,880 E1486G probably damaging Het
Pign A T 1: 105,597,666 probably null Het
Pik3r4 A G 9: 105,672,725 H1005R probably damaging Het
Ppp6r1 A C 7: 4,641,046 probably null Het
Ptdss2 A G 7: 141,154,578 T309A probably benign Het
Ptprt T C 2: 161,564,689 M987V probably damaging Het
Rgs17 C A 10: 5,918,192 L9F probably benign Het
Rock2 A G 12: 16,977,737 R168G probably damaging Het
Rsph4a T A 10: 33,911,627 L593* probably null Het
Scaf11 C A 15: 96,424,838 K108N probably damaging Het
Sec23b T A 2: 144,582,015 M528K possibly damaging Het
Shank2 G A 7: 144,410,205 D727N probably damaging Het
Sipa1l2 T C 8: 125,492,226 D124G probably benign Het
Tmem126b A G 7: 90,469,108 L188P probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Vmn2r62 A G 7: 42,764,533 F829L probably damaging Het
Other mutations in Spatc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Spatc1 APN 15 76284794 missense probably damaging 1.00
IGL02215:Spatc1 APN 15 76283539 splice site probably benign
IGL02678:Spatc1 APN 15 76292372 missense probably damaging 1.00
R0452:Spatc1 UTSW 15 76268293 missense probably damaging 1.00
R1972:Spatc1 UTSW 15 76284875 intron probably null
R2066:Spatc1 UTSW 15 76283537 splice site probably null
R2921:Spatc1 UTSW 15 76283925 missense probably damaging 1.00
R3689:Spatc1 UTSW 15 76268295 nonsense probably null
R3690:Spatc1 UTSW 15 76268295 nonsense probably null
R5944:Spatc1 UTSW 15 76283938 missense probably damaging 1.00
R7008:Spatc1 UTSW 15 76283723 missense probably benign 0.00
R7034:Spatc1 UTSW 15 76283880 missense probably benign 0.00
R7036:Spatc1 UTSW 15 76283880 missense probably benign 0.00
R7436:Spatc1 UTSW 15 76268368 missense probably benign 0.21
X0023:Spatc1 UTSW 15 76268372 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TCAATGAGTACGGCATCCTG -3'
(R):5'- AAAGGGAATTTGGGACCTTCC -3'

Sequencing Primer
(F):5'- TACGGCATCCTGCGCGAG -3'
(R):5'- AAGACAGTGTCTGAGAGCTCTGTC -3'
Posted On2015-08-18