Incidental Mutation 'R4519:Piezo2'
ID 334150
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Name piezo-type mechanosensitive ion channel component 2
Synonyms Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik
MMRRC Submission 041590-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4519 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 63010213-63387183 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63072880 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1486 (E1486G)
Ref Sequence ENSEMBL: ENSMUSP00000040019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047480] [ENSMUST00000183217]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000047480
AA Change: E1486G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: E1486G

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183217
AA Change: E1472G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: E1472G

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 886 907 N/A INTRINSIC
transmembrane domain 935 957 N/A INTRINSIC
transmembrane domain 962 979 N/A INTRINSIC
transmembrane domain 986 1008 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
transmembrane domain 1142 1159 N/A INTRINSIC
transmembrane domain 1172 1194 N/A INTRINSIC
transmembrane domain 1220 1242 N/A INTRINSIC
transmembrane domain 1294 1313 N/A INTRINSIC
transmembrane domain 1317 1339 N/A INTRINSIC
transmembrane domain 1352 1374 N/A INTRINSIC
coiled coil region 1460 1501 N/A INTRINSIC
low complexity region 1528 1537 N/A INTRINSIC
low complexity region 1558 1575 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A G 9: 114,300,024 (GRCm38) noncoding transcript Het
Acadsb A T 7: 131,430,004 (GRCm38) T190S probably damaging Het
Adamts17 G T 7: 66,840,566 (GRCm38) G132V probably damaging Het
Atosa A G 9: 75,023,647 (GRCm38) I957M probably damaging Het
Atp8b3 C T 10: 80,523,847 (GRCm38) M984I probably benign Het
Atp8b4 A T 2: 126,414,459 (GRCm38) probably null Het
Btbd18 T C 2: 84,667,580 (GRCm38) Y521H probably damaging Het
Casd1 A G 6: 4,621,102 (GRCm38) N220S probably benign Het
Ccdc112 T G 18: 46,287,546 (GRCm38) E379A possibly damaging Het
Ccdc88a T C 11: 29,482,651 (GRCm38) I1219T probably benign Het
Cntrl A T 2: 35,173,111 (GRCm38) K1573M probably damaging Het
Col14a1 A T 15: 55,388,579 (GRCm38) I544F unknown Het
Cyp20a1 A T 1: 60,387,147 (GRCm38) Y416F probably damaging Het
Dagla T C 19: 10,269,732 (GRCm38) K132E probably damaging Het
Dbn1 A T 13: 55,476,229 (GRCm38) I350N possibly damaging Het
Ddx41 A T 13: 55,533,144 (GRCm38) V329E probably damaging Het
Dhx32 A T 7: 133,734,109 (GRCm38) Y272N probably damaging Het
Fam114a1 C A 5: 65,005,882 (GRCm38) P174Q probably benign Het
Galnt3 C A 2: 66,093,610 (GRCm38) R438L probably damaging Het
Ghr T A 15: 3,333,488 (GRCm38) L167F probably damaging Het
Glod4 T A 11: 76,243,571 (GRCm38) D25V probably damaging Het
Gm9767 T C 10: 26,078,858 (GRCm38) probably benign Het
Golga4 T A 9: 118,559,008 (GRCm38) S1733T probably benign Het
Gsdme A T 6: 50,229,353 (GRCm38) I170N probably damaging Het
H2-M10.3 C T 17: 36,367,830 (GRCm38) probably null Het
Kmt2c T A 5: 25,363,477 (GRCm38) K867M probably damaging Het
Krt35 A G 11: 100,094,627 (GRCm38) V196A possibly damaging Het
Ltbp1 A T 17: 75,364,497 (GRCm38) M1558L probably benign Het
Mcam T G 9: 44,141,343 (GRCm38) M623R possibly damaging Het
Mrps26 A T 2: 130,564,349 (GRCm38) Q134L probably benign Het
Mxra8 T C 4: 155,842,983 (GRCm38) probably null Het
Or13a21 A G 7: 140,419,210 (GRCm38) S188P probably damaging Het
Or52n20 G A 7: 104,670,839 (GRCm38) G46R probably damaging Het
Orc4 G A 2: 48,937,489 (GRCm38) P31S probably benign Het
Pabir3 G A X: 53,293,499 (GRCm38) R94H possibly damaging Het
Parg C A 14: 32,209,635 (GRCm38) T404K probably damaging Het
Parp8 C A 13: 116,895,673 (GRCm38) L321F possibly damaging Het
Pign A T 1: 105,597,666 (GRCm38) probably null Het
Pik3r4 A G 9: 105,672,725 (GRCm38) H1005R probably damaging Het
Ppp6r1 A C 7: 4,641,046 (GRCm38) probably null Het
Ptdss2 A G 7: 141,154,578 (GRCm38) T309A probably benign Het
Ptprt T C 2: 161,564,689 (GRCm38) M987V probably damaging Het
Rgs17 C A 10: 5,918,192 (GRCm38) L9F probably benign Het
Rock2 A G 12: 16,977,737 (GRCm38) R168G probably damaging Het
Rsph4a T A 10: 33,911,627 (GRCm38) L593* probably null Het
Scaf11 C A 15: 96,424,838 (GRCm38) K108N probably damaging Het
Sec23b T A 2: 144,582,015 (GRCm38) M528K possibly damaging Het
Shank2 G A 7: 144,410,205 (GRCm38) D727N probably damaging Het
Sipa1l2 T C 8: 125,492,226 (GRCm38) D124G probably benign Het
Spatc1 A T 15: 76,292,485 (GRCm38) I479F probably damaging Het
Tmem126b A G 7: 90,469,108 (GRCm38) L188P probably damaging Het
Tnrc6b T G 15: 80,880,247 (GRCm38) L650W probably damaging Het
Vmn2r62 A G 7: 42,764,533 (GRCm38) F829L probably damaging Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63,117,699 (GRCm38) missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63,022,460 (GRCm38) missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63,070,030 (GRCm38) missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63,124,614 (GRCm38) missense probably benign 0.03
IGL01568:Piezo2 APN 18 63,030,392 (GRCm38) missense probably benign 0.28
IGL01653:Piezo2 APN 18 63,182,833 (GRCm38) splice site probably benign
IGL01674:Piezo2 APN 18 63,027,559 (GRCm38) missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63,083,170 (GRCm38) missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63,042,788 (GRCm38) missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63,092,844 (GRCm38) missense probably benign 0.10
IGL02183:Piezo2 APN 18 63,020,634 (GRCm38) missense probably benign 0.00
IGL02407:Piezo2 APN 18 63,146,844 (GRCm38) missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63,072,862 (GRCm38) missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63,032,924 (GRCm38) missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63,024,475 (GRCm38) missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63,074,659 (GRCm38) missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63,020,633 (GRCm38) missense probably benign 0.18
IGL02851:Piezo2 APN 18 63,020,633 (GRCm38) missense probably benign 0.18
IGL02972:Piezo2 APN 18 63,064,785 (GRCm38) splice site probably benign
IGL03011:Piezo2 APN 18 63,124,660 (GRCm38) missense probably benign 0.03
IGL03078:Piezo2 APN 18 63,070,075 (GRCm38) missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63,030,272 (GRCm38) splice site probably null
IGL03129:Piezo2 APN 18 63,114,972 (GRCm38) missense probably benign
IGL03143:Piezo2 APN 18 63,108,076 (GRCm38) missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63,011,598 (GRCm38) missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63,124,606 (GRCm38) missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63,053,062 (GRCm38) missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63,041,720 (GRCm38) missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63,011,538 (GRCm38) utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63,021,308 (GRCm38) missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63,027,704 (GRCm38) missense probably damaging 1.00
Piccolo UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
sopranino UTSW 18 63,024,466 (GRCm38) missense probably damaging 1.00
woodwind UTSW 18 63,124,642 (GRCm38) missense possibly damaging 0.50
P0023:Piezo2 UTSW 18 63,386,200 (GRCm38) splice site probably benign
PIT4802001:Piezo2 UTSW 18 63,024,469 (GRCm38) missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63,102,084 (GRCm38) missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63,024,491 (GRCm38) missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63,029,061 (GRCm38) missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63,102,174 (GRCm38) missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63,024,451 (GRCm38) missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63,027,544 (GRCm38) missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63,022,481 (GRCm38) missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63,022,426 (GRCm38) missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63,019,258 (GRCm38) missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63,041,723 (GRCm38) missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63,083,235 (GRCm38) missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63,015,802 (GRCm38) missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63,086,753 (GRCm38) missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63,021,254 (GRCm38) missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63,083,131 (GRCm38) missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63,144,919 (GRCm38) missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63,082,915 (GRCm38) missense probably benign 0.03
R1649:Piezo2 UTSW 18 63,117,672 (GRCm38) missense probably benign 0.34
R1741:Piezo2 UTSW 18 63,021,173 (GRCm38) missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63,124,642 (GRCm38) missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63,106,284 (GRCm38) missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63,108,087 (GRCm38) missense probably damaging 1.00
R1799:Piezo2 UTSW 18 63,032,840 (GRCm38) critical splice donor site probably null
R1868:Piezo2 UTSW 18 63,019,344 (GRCm38) missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63,113,960 (GRCm38) missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63,078,840 (GRCm38) missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63,074,662 (GRCm38) missense probably null 1.00
R1991:Piezo2 UTSW 18 63,074,662 (GRCm38) missense probably null 1.00
R1992:Piezo2 UTSW 18 63,074,662 (GRCm38) missense probably null 1.00
R1995:Piezo2 UTSW 18 63,078,781 (GRCm38) missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63,144,926 (GRCm38) missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63,059,744 (GRCm38) missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63,118,935 (GRCm38) missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63,081,734 (GRCm38) missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63,117,720 (GRCm38) missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63,114,041 (GRCm38) missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63,081,662 (GRCm38) critical splice donor site probably null
R2183:Piezo2 UTSW 18 63,106,274 (GRCm38) missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63,145,072 (GRCm38) missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63,145,072 (GRCm38) missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63,022,525 (GRCm38) missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63,245,624 (GRCm38) missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63,053,035 (GRCm38) missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63,146,843 (GRCm38) missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63,024,435 (GRCm38) nonsense probably null
R3016:Piezo2 UTSW 18 63,042,832 (GRCm38) missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63,081,793 (GRCm38) missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63,081,662 (GRCm38) critical splice donor site probably null
R3833:Piezo2 UTSW 18 63,081,662 (GRCm38) critical splice donor site probably null
R3968:Piezo2 UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63,011,696 (GRCm38) missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63,050,604 (GRCm38) missense probably benign
R4181:Piezo2 UTSW 18 63,124,730 (GRCm38) critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63,084,840 (GRCm38) missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63,124,730 (GRCm38) critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63,102,099 (GRCm38) missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63,114,063 (GRCm38) missense probably damaging 0.98
R4539:Piezo2 UTSW 18 63,086,628 (GRCm38) missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63,069,963 (GRCm38) missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63,030,401 (GRCm38) missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63,030,401 (GRCm38) missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63,144,954 (GRCm38) missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63,078,791 (GRCm38) missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63,157,262 (GRCm38) missense probably benign
R4961:Piezo2 UTSW 18 63,052,961 (GRCm38) splice site probably null
R4968:Piezo2 UTSW 18 63,144,971 (GRCm38) nonsense probably null
R4973:Piezo2 UTSW 18 63,074,680 (GRCm38) missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63,083,113 (GRCm38) missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63,024,536 (GRCm38) missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63,074,620 (GRCm38) missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63,030,409 (GRCm38) missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63,032,929 (GRCm38) missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63,064,731 (GRCm38) missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63,084,740 (GRCm38) missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63,145,105 (GRCm38) missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63,027,864 (GRCm38) missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63,011,721 (GRCm38) missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63,145,091 (GRCm38) missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63,117,697 (GRCm38) missense probably benign 0.25
R5677:Piezo2 UTSW 18 63,117,696 (GRCm38) missense possibly damaging 0.94
R5792:Piezo2 UTSW 18 63,146,856 (GRCm38) missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63,027,901 (GRCm38) missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63,113,934 (GRCm38) missense probably benign 0.22
R6036:Piezo2 UTSW 18 63,114,948 (GRCm38) nonsense probably null
R6036:Piezo2 UTSW 18 63,114,948 (GRCm38) nonsense probably null
R6073:Piezo2 UTSW 18 63,012,645 (GRCm38) missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63,157,210 (GRCm38) nonsense probably null
R6255:Piezo2 UTSW 18 63,121,270 (GRCm38) missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63,117,678 (GRCm38) missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63,106,293 (GRCm38) missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63,086,607 (GRCm38) missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63,041,663 (GRCm38) missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63,106,271 (GRCm38) missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63,021,328 (GRCm38) missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63,021,262 (GRCm38) missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63,032,889 (GRCm38) nonsense probably null
R6855:Piezo2 UTSW 18 63,090,879 (GRCm38) critical splice donor site probably null
R6927:Piezo2 UTSW 18 63,032,986 (GRCm38) missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63,082,961 (GRCm38) critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63,145,110 (GRCm38) nonsense probably null
R7162:Piezo2 UTSW 18 63,124,709 (GRCm38) missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63,108,030 (GRCm38) missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63,017,519 (GRCm38) splice site probably null
R7395:Piezo2 UTSW 18 63,027,563 (GRCm38) missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63,024,472 (GRCm38) missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63,012,723 (GRCm38) missense probably benign
R7517:Piezo2 UTSW 18 63,082,925 (GRCm38) missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63,053,010 (GRCm38) missense probably benign 0.01
R7612:Piezo2 UTSW 18 63,042,539 (GRCm38) missense probably benign 0.12
R7829:Piezo2 UTSW 18 63,113,876 (GRCm38) critical splice donor site probably null
R7835:Piezo2 UTSW 18 63,082,945 (GRCm38) missense probably benign 0.12
R8014:Piezo2 UTSW 18 63,083,200 (GRCm38) missense probably benign 0.02
R8055:Piezo2 UTSW 18 63,042,811 (GRCm38) missense probably damaging 0.99
R8062:Piezo2 UTSW 18 63,030,466 (GRCm38) missense possibly damaging 0.87
R8306:Piezo2 UTSW 18 63,075,730 (GRCm38) missense probably damaging 1.00
R8332:Piezo2 UTSW 18 63,012,786 (GRCm38) missense possibly damaging 0.67
R8355:Piezo2 UTSW 18 63,090,998 (GRCm38) missense probably damaging 1.00
R8383:Piezo2 UTSW 18 63,084,688 (GRCm38) missense probably damaging 0.97
R8455:Piezo2 UTSW 18 63,090,998 (GRCm38) missense probably damaging 1.00
R8501:Piezo2 UTSW 18 63,045,540 (GRCm38) missense probably damaging 0.99
R8523:Piezo2 UTSW 18 63,146,802 (GRCm38) missense probably damaging 0.99
R8692:Piezo2 UTSW 18 63,092,900 (GRCm38) nonsense probably null
R8708:Piezo2 UTSW 18 63,093,015 (GRCm38) missense probably damaging 1.00
R8726:Piezo2 UTSW 18 63,109,885 (GRCm38) missense probably benign
R8727:Piezo2 UTSW 18 63,109,885 (GRCm38) missense probably benign
R8810:Piezo2 UTSW 18 63,114,963 (GRCm38) missense probably benign 0.41
R8900:Piezo2 UTSW 18 63,115,025 (GRCm38) missense probably benign 0.04
R9037:Piezo2 UTSW 18 63,092,831 (GRCm38) missense probably benign 0.31
R9079:Piezo2 UTSW 18 63,024,466 (GRCm38) missense probably damaging 1.00
R9090:Piezo2 UTSW 18 63,075,719 (GRCm38) missense probably damaging 0.99
R9090:Piezo2 UTSW 18 63,030,379 (GRCm38) missense probably damaging 0.99
R9123:Piezo2 UTSW 18 63,045,518 (GRCm38) missense probably benign 0.00
R9125:Piezo2 UTSW 18 63,045,518 (GRCm38) missense probably benign 0.00
R9171:Piezo2 UTSW 18 63,045,479 (GRCm38) missense probably benign 0.04
R9194:Piezo2 UTSW 18 63,117,744 (GRCm38) missense probably benign 0.03
R9203:Piezo2 UTSW 18 63,157,231 (GRCm38) missense probably benign 0.00
R9209:Piezo2 UTSW 18 63,021,301 (GRCm38) missense probably damaging 1.00
R9261:Piezo2 UTSW 18 63,075,797 (GRCm38) missense possibly damaging 0.84
R9271:Piezo2 UTSW 18 63,030,379 (GRCm38) missense probably damaging 0.99
R9271:Piezo2 UTSW 18 63,075,719 (GRCm38) missense probably damaging 0.99
R9283:Piezo2 UTSW 18 63,024,566 (GRCm38) missense probably damaging 1.00
R9377:Piezo2 UTSW 18 63,029,085 (GRCm38) missense possibly damaging 0.48
R9499:Piezo2 UTSW 18 63,032,962 (GRCm38) missense possibly damaging 0.67
R9531:Piezo2 UTSW 18 63,102,165 (GRCm38) missense possibly damaging 0.95
R9551:Piezo2 UTSW 18 63,032,962 (GRCm38) missense possibly damaging 0.67
R9607:Piezo2 UTSW 18 63,386,276 (GRCm38) start gained probably benign
R9608:Piezo2 UTSW 18 63,146,945 (GRCm38) missense probably benign 0.09
R9617:Piezo2 UTSW 18 63,115,037 (GRCm38) missense probably benign 0.43
R9624:Piezo2 UTSW 18 63,064,696 (GRCm38) missense possibly damaging 0.88
X0017:Piezo2 UTSW 18 63,027,586 (GRCm38) missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63,050,610 (GRCm38) missense probably benign 0.43
X0060:Piezo2 UTSW 18 63,017,577 (GRCm38) missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63,069,994 (GRCm38) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAGCATAGCAGGGTTGGTG -3'
(R):5'- GGTGACTTCAGCCAGGAAACATC -3'

Sequencing Primer
(F):5'- GTGCCTCATCTGACAGAGGAATC -3'
(R):5'- GGAAACATCTGTCAACCTGGGC -3'
Posted On 2015-08-18