Incidental Mutation 'R0207:Smc6'
ID 33416
Institutional Source Beutler Lab
Gene Symbol Smc6
Ensembl Gene ENSMUSG00000020608
Gene Name structural maintenance of chromosomes 6
Synonyms 3830418C19Rik, Smc6l1, 2810489L22Rik
MMRRC Submission 038460-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0207 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 11315887-11369786 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 11333179 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020931] [ENSMUST00000217906] [ENSMUST00000218022] [ENSMUST00000218866] [ENSMUST00000219776]
AlphaFold Q924W5
Predicted Effect probably benign
Transcript: ENSMUST00000020931
SMART Domains Protein: ENSMUSP00000020931
Gene: ENSMUSG00000020608

DomainStartEndE-ValueType
Pfam:SMC_N 53 1077 4.7e-17 PFAM
Pfam:AAA_15 54 438 3.1e-9 PFAM
Pfam:AAA_23 56 398 5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217906
Predicted Effect probably benign
Transcript: ENSMUST00000218022
Predicted Effect probably benign
Transcript: ENSMUST00000218866
Predicted Effect probably benign
Transcript: ENSMUST00000219776
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 95% (76/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit poor embryonic development and embryonic lethality by E105. Mice homozygous for a hypomorphic allele exhibit decreased body weight and weight, decreased litter size and partial lethality. Mice homozygous for a point mutation exhibit a milder phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,086,039 (GRCm39) F488S probably damaging Het
Acap3 C T 4: 155,983,881 (GRCm39) R116W probably damaging Het
Adamts10 C A 17: 33,764,364 (GRCm39) P663T possibly damaging Het
Akap12 G A 10: 4,303,333 (GRCm39) G48S probably damaging Het
Ankrd7 T A 6: 18,870,030 (GRCm39) M261K probably benign Het
Ankzf1 C A 1: 75,174,948 (GRCm39) D599E possibly damaging Het
Aox1 T C 1: 58,144,173 (GRCm39) I1278T possibly damaging Het
Apcdd1 T C 18: 63,083,150 (GRCm39) Y327H probably benign Het
Asxl3 T A 18: 22,544,553 (GRCm39) probably benign Het
Birc6 C A 17: 74,969,827 (GRCm39) probably benign Het
Btaf1 T A 19: 36,987,048 (GRCm39) L1714* probably null Het
Cacng6 T A 7: 3,473,520 (GRCm39) probably benign Het
Cdc20b A G 13: 113,215,146 (GRCm39) D238G probably damaging Het
Celf5 T A 10: 81,306,532 (GRCm39) R113W probably null Het
Cfap251 T C 5: 123,421,510 (GRCm39) V182A probably damaging Het
Cfap70 C A 14: 20,462,415 (GRCm39) E659D probably damaging Het
Clspn T A 4: 126,484,391 (GRCm39) M1183K possibly damaging Het
Dpy19l1 G A 9: 24,365,187 (GRCm39) R275C probably damaging Het
Dst C T 1: 34,226,016 (GRCm39) S1721L probably benign Het
Faap100 T C 11: 120,265,191 (GRCm39) T562A probably damaging Het
Fam168b T C 1: 34,858,769 (GRCm39) M133V probably damaging Het
Farp2 T C 1: 93,496,809 (GRCm39) I172T probably damaging Het
Fer T G 17: 64,203,273 (GRCm39) S68A probably damaging Het
Fmo5 A G 3: 97,552,997 (GRCm39) E315G probably damaging Het
Gpr89 A T 3: 96,778,796 (GRCm39) F426I probably damaging Het
Hinfp T C 9: 44,207,624 (GRCm39) I461V possibly damaging Het
Hsd11b1 A T 1: 192,922,556 (GRCm39) V167D probably damaging Het
Htt A G 5: 35,054,252 (GRCm39) K2574E probably benign Het
I830077J02Rik A G 3: 105,833,821 (GRCm39) S112P probably benign Het
Igf2bp3 T A 6: 49,082,551 (GRCm39) M344L probably benign Het
Itch A T 2: 155,044,177 (GRCm39) Q494L probably benign Het
Itga9 T C 9: 118,598,321 (GRCm39) probably benign Het
Jaml T A 9: 45,005,065 (GRCm39) D152E probably benign Het
Kif22 A C 7: 126,641,572 (GRCm39) M1R probably null Het
Kifap3 T C 1: 163,710,955 (GRCm39) Y663H probably benign Het
Letm2 T A 8: 26,068,786 (GRCm39) N472I probably damaging Het
Mthfr T G 4: 148,136,681 (GRCm39) V446G probably damaging Het
Myh11 T C 16: 14,029,124 (GRCm39) E1206G possibly damaging Het
Myo6 G A 9: 80,195,338 (GRCm39) V903I probably damaging Het
Myo9b C T 8: 71,807,869 (GRCm39) probably benign Het
Nr2f2 G C 7: 70,009,923 (GRCm39) P52R probably damaging Het
Nsd3 A G 8: 26,173,273 (GRCm39) N859S probably benign Het
Nucb2 C A 7: 116,135,245 (GRCm39) A384E probably damaging Het
Ogdhl C A 14: 32,063,994 (GRCm39) probably null Het
Or10al3 C A 17: 38,011,949 (GRCm39) C129* probably null Het
Or1e22 A T 11: 73,377,401 (GRCm39) L83Q probably benign Het
Or1i2 T C 10: 78,447,705 (GRCm39) T257A probably benign Het
Or4a74 G A 2: 89,440,207 (GRCm39) L80F probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Parp10 C T 15: 76,126,833 (GRCm39) S145N probably benign Het
Pigh A G 12: 79,130,483 (GRCm39) probably benign Het
Pigo A G 4: 43,023,824 (GRCm39) probably benign Het
Pkp4 T A 2: 59,135,832 (GRCm39) V199D possibly damaging Het
Polr1e C A 4: 45,025,143 (GRCm39) probably null Het
Ppfia3 C A 7: 44,997,958 (GRCm39) R723L probably damaging Het
Prex1 C A 2: 166,427,818 (GRCm39) A945S possibly damaging Het
Prrt3 A T 6: 113,472,801 (GRCm39) V457E probably damaging Het
Rab39 A G 9: 53,617,271 (GRCm39) F49L possibly damaging Het
Rrs1 C A 1: 9,615,987 (GRCm39) probably null Het
Rrs1 G A 1: 9,615,992 (GRCm39) E82K probably damaging Het
Serpinb3c T C 1: 107,204,722 (GRCm39) D8G probably benign Het
Slc17a6 A G 7: 51,295,928 (GRCm39) probably benign Het
Slc24a4 T A 12: 102,195,210 (GRCm39) probably null Het
Smc1b C T 15: 85,007,960 (GRCm39) M272I probably benign Het
Tcf20 T C 15: 82,739,286 (GRCm39) T722A probably benign Het
Tesmin A T 19: 3,454,088 (GRCm39) M141L probably benign Het
Tmprss5 T A 9: 49,024,460 (GRCm39) H274Q possibly damaging Het
Tns1 C T 1: 73,976,477 (GRCm39) probably null Het
Tpr T C 1: 150,293,178 (GRCm39) S868P possibly damaging Het
Trank1 C T 9: 111,195,321 (GRCm39) T1115I probably damaging Het
Trmt44 A T 5: 35,730,261 (GRCm39) I203K possibly damaging Het
Ulk2 A T 11: 61,668,611 (GRCm39) V1037E probably benign Het
Usp43 A G 11: 67,767,325 (GRCm39) Y682H probably damaging Het
Vipr2 A T 12: 116,106,502 (GRCm39) Q366L probably damaging Het
Vmn1r185 C A 7: 26,311,014 (GRCm39) V164L possibly damaging Het
Vmn2r120 C T 17: 57,832,052 (GRCm39) V246I probably benign Het
Wiz C T 17: 32,576,007 (GRCm39) G790R probably damaging Het
Wnk1 A T 6: 119,929,694 (GRCm39) S1016R probably damaging Het
Zc3hav1 A G 6: 38,288,109 (GRCm39) L909S probably benign Het
Zfp236 T A 18: 82,658,352 (GRCm39) I637F probably damaging Het
Zfp788 G A 7: 41,299,020 (GRCm39) G532D probably damaging Het
Zranb1 T C 7: 132,552,114 (GRCm39) I255T probably damaging Het
Other mutations in Smc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Smc6 APN 12 11,349,264 (GRCm39) missense possibly damaging 0.48
IGL00562:Smc6 APN 12 11,351,532 (GRCm39) missense probably benign 0.02
IGL00563:Smc6 APN 12 11,351,532 (GRCm39) missense probably benign 0.02
IGL01420:Smc6 APN 12 11,341,659 (GRCm39) missense probably benign 0.27
IGL02299:Smc6 APN 12 11,340,752 (GRCm39) missense probably benign 0.00
R0365:Smc6 UTSW 12 11,333,175 (GRCm39) critical splice donor site probably null
R0669:Smc6 UTSW 12 11,339,165 (GRCm39) missense probably benign 0.41
R0732:Smc6 UTSW 12 11,340,818 (GRCm39) missense probably damaging 0.96
R1398:Smc6 UTSW 12 11,321,880 (GRCm39) splice site probably benign
R1509:Smc6 UTSW 12 11,329,734 (GRCm39) missense possibly damaging 0.55
R1739:Smc6 UTSW 12 11,367,854 (GRCm39) missense probably benign 0.05
R1775:Smc6 UTSW 12 11,359,270 (GRCm39) missense probably benign 0.00
R1815:Smc6 UTSW 12 11,344,602 (GRCm39) critical splice donor site probably null
R1937:Smc6 UTSW 12 11,349,399 (GRCm39) missense probably benign 0.06
R2090:Smc6 UTSW 12 11,339,987 (GRCm39) missense probably benign 0.08
R2885:Smc6 UTSW 12 11,326,294 (GRCm39) missense probably damaging 0.99
R2886:Smc6 UTSW 12 11,326,294 (GRCm39) missense probably damaging 0.99
R2991:Smc6 UTSW 12 11,339,982 (GRCm39) missense probably damaging 0.96
R3825:Smc6 UTSW 12 11,351,517 (GRCm39) splice site probably benign
R3967:Smc6 UTSW 12 11,348,327 (GRCm39) missense probably benign 0.13
R3975:Smc6 UTSW 12 11,324,075 (GRCm39) missense probably damaging 0.99
R4660:Smc6 UTSW 12 11,324,008 (GRCm39) missense probably damaging 1.00
R5372:Smc6 UTSW 12 11,332,431 (GRCm39) missense probably damaging 1.00
R5412:Smc6 UTSW 12 11,335,400 (GRCm39) missense possibly damaging 0.88
R5523:Smc6 UTSW 12 11,341,540 (GRCm39) missense probably benign 0.31
R5643:Smc6 UTSW 12 11,339,995 (GRCm39) missense probably benign 0.18
R5644:Smc6 UTSW 12 11,339,995 (GRCm39) missense probably benign 0.18
R5782:Smc6 UTSW 12 11,340,835 (GRCm39) missense probably damaging 1.00
R6027:Smc6 UTSW 12 11,356,179 (GRCm39) missense probably benign 0.04
R6083:Smc6 UTSW 12 11,326,354 (GRCm39) missense possibly damaging 0.95
R6344:Smc6 UTSW 12 11,347,107 (GRCm39) intron probably benign
R6374:Smc6 UTSW 12 11,355,874 (GRCm39) splice site probably null
R6430:Smc6 UTSW 12 11,359,235 (GRCm39) missense probably benign 0.00
R6539:Smc6 UTSW 12 11,347,011 (GRCm39) splice site probably null
R6767:Smc6 UTSW 12 11,321,821 (GRCm39) missense possibly damaging 0.93
R7042:Smc6 UTSW 12 11,359,301 (GRCm39) missense probably damaging 1.00
R7128:Smc6 UTSW 12 11,351,632 (GRCm39) missense probably damaging 1.00
R7477:Smc6 UTSW 12 11,321,808 (GRCm39) missense probably benign
R7698:Smc6 UTSW 12 11,333,141 (GRCm39) missense possibly damaging 0.92
R7832:Smc6 UTSW 12 11,367,844 (GRCm39) missense probably benign 0.28
R7863:Smc6 UTSW 12 11,339,130 (GRCm39) missense probably benign 0.00
R8192:Smc6 UTSW 12 11,349,336 (GRCm39) missense probably benign 0.01
R8229:Smc6 UTSW 12 11,341,673 (GRCm39) missense probably benign 0.25
R8289:Smc6 UTSW 12 11,324,052 (GRCm39) missense probably benign 0.41
R9233:Smc6 UTSW 12 11,359,291 (GRCm39) missense probably benign 0.15
R9596:Smc6 UTSW 12 11,345,045 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACGTTTTGAGGGCCAAATTTTCTCTTT -3'
(R):5'- CAGTGATGCCTTGCACAACCAATTAG -3'

Sequencing Primer
(F):5'- CTTTGTTTTTACACTACAAGCCTAC -3'
(R):5'- tgtatgaatacacacacacacac -3'
Posted On 2013-05-09