Mutagenetix > Incidental Mutation

Incidental Mutation 'R4520:Fbxo41'

334173

Institutional Source

Beutler Lab

Gene Symbol

Fbxo41

Ensembl Gene

ENSMUSG00000047013

Gene Name

F-box protein 41

Synonyms

D6Ertd538e

MMRRC Submission

041763-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.475) question?

Stock #

R4520 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85469574-85502994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85484042 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 228 (I228T)

Ref Sequence

ENSEMBL: ENSMUSP00000124754 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159062] [ENSMUST00000161078] [ENSMUST00000161546]

AlphaFold

Q6NS60

Predicted Effect

probably damaging
Transcript: ENSMUST00000159062
AA Change: I228T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125671
Gene: ENSMUSG00000047013
AA Change: I228T

Domain	Start	End	E-Value	Type
ZnF_C2H2	8	33	5.81e-2	SMART
low complexity region	65	77	N/A	INTRINSIC
low complexity region	100	122	N/A	INTRINSIC
low complexity region	162	192	N/A	INTRINSIC
SCOP:d1eq1a_	197	340	2e-5	SMART
low complexity region	352	374	N/A	INTRINSIC
low complexity region	425	440	N/A	INTRINSIC
Pfam:F-box	536	592	4.8e-5	PFAM
Pfam:F-box-like	554	593	9e-10	PFAM
low complexity region	745	759	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161078
AA Change: I228T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124524
Gene: ENSMUSG00000047013
AA Change: I228T

Domain	Start	End	E-Value	Type
ZnF_C2H2	8	33	5.81e-2	SMART
low complexity region	65	77	N/A	INTRINSIC
low complexity region	100	122	N/A	INTRINSIC
low complexity region	162	192	N/A	INTRINSIC
SCOP:d1eq1a_	197	340	2e-5	SMART
low complexity region	352	374	N/A	INTRINSIC
low complexity region	425	440	N/A	INTRINSIC
Pfam:F-box	536	592	4.8e-5	PFAM
Pfam:F-box-like	554	593	9e-10	PFAM
low complexity region	745	759	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161546
AA Change: I228T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124754
Gene: ENSMUSG00000047013
AA Change: I228T

Domain	Start	End	E-Value	Type
ZnF_C2H2	8	33	5.81e-2	SMART
low complexity region	65	77	N/A	INTRINSIC
low complexity region	100	122	N/A	INTRINSIC
low complexity region	162	192	N/A	INTRINSIC
SCOP:d1eq1a_	197	340	2e-5	SMART
low complexity region	352	374	N/A	INTRINSIC
low complexity region	425	440	N/A	INTRINSIC
low complexity region	519	540	N/A	INTRINSIC
Pfam:F-box-like	554	593	5.6e-10	PFAM
low complexity region	745	759	N/A	INTRINSIC

Meta Mutation Damage Score

0.2564

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which is characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one of the four subunits of the SCF ubiquitin protein ligase complex that plays a role in phosphorylation-dependent ubiquitination. F-box proteins are divided into three classes depending on the interaction substrate domain each contains in addition to the F-box motif: FBXW proteins contain WD-40 domains, FBXL proteins contain leucine-rich repeats, and FBXO proteins contain either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the FBXO class. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality and premature death by 10 weeks, growth retardation, abnormal gait, dragging hindlimbs, ataxia, impaired balance, impaired coordination, tremors and abnormal neuronal migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,070,266	T1739A	probably damaging	Het
Ascc3	A	G	10: 50,660,670	N700D	probably benign	Het
Ccdc88c	G	T	12: 100,913,332	S1843R	possibly damaging	Het
Cel	C	T	2: 28,557,968	V349M	probably benign	Het
Cspp1	A	G	1: 10,134,227	T1127A	probably benign	Het
Cyp2b10	T	C	7: 25,911,557	V113A	probably benign	Het
Cyp2c50	A	G	19: 40,090,689	T159A	probably benign	Het
Degs1	T	C	1: 182,276,808	D304G	possibly damaging	Het
Esr2	G	A	12: 76,167,549	P43S	possibly damaging	Het
Gm5444	A	G	13: 4,834,226		noncoding transcript	Het
Golga3	T	A	5: 110,203,751	L790*	probably null	Het
Gtpbp6	T	C	5: 110,107,859	T105A	probably benign	Het
Ido2	T	C	8: 24,576,178	E24G	probably damaging	Het
Ihh	T	A	1: 74,950,950	I89F	probably damaging	Het
Krt13	A	G	11: 100,119,348	M269T	probably damaging	Het
Marf1	T	C	16: 14,132,666	H952R	probably damaging	Het
Mga	T	A	2: 119,948,098	F2041L	possibly damaging	Het
Msmo1	A	C	8: 64,720,523		probably benign	Het
Mterf1a	A	G	5: 3,890,992	V292A	probably damaging	Het
Naxe	A	G	3: 88,057,982		probably null	Het
Ntng1	A	G	3: 109,934,996	S154P	probably damaging	Het
Olfr1097	T	C	2: 86,891,019	D52G	probably benign	Het
Olfr572	A	T	7: 102,928,557	I310F	probably benign	Het
Olfr657	T	A	7: 104,636,169	V165E	probably damaging	Het
Otog	T	A	7: 46,241,053		probably benign	Het
Pigo	A	T	4: 43,020,301	H880Q	probably benign	Het
Plce1	T	C	19: 38,524,319	S21P	possibly damaging	Het
Pole	T	A	5: 110,297,924	D555E	probably damaging	Het
Prkag2	A	G	5: 24,866,171	V403A	probably damaging	Het
Psg28	T	A	7: 18,422,901	M470L	probably benign	Het
Rpgrip1	A	G	14: 52,152,289	T1138A	probably benign	Het
Rpl10l	T	C	12: 66,283,738	D207G	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Serpinb9c	T	C	13: 33,151,857		probably null	Het
Sh2d6	T	C	6: 72,518,953	N101D	possibly damaging	Het
Shisa8	C	G	15: 82,211,962	V151L	possibly damaging	Het
Slc13a1	T	C	6: 24,134,513	T124A	probably benign	Het
Slc6a3	G	A	13: 73,540,856	V100M	possibly damaging	Het
Sspn	A	G	6: 145,961,307	T79A	probably benign	Het
Tlr8	C	T	X: 167,243,175	R893H	probably damaging	Het
Tnrc18	T	C	5: 142,732,150	K2183R	unknown	Het
Trim15	T	C	17: 36,866,350	I139M	probably benign	Het
Trmt13	A	T	3: 116,581,613		probably null	Het
Vmn2r84	T	A	10: 130,386,522	T610S	probably damaging	Het
Zcchc14	A	T	8: 121,609,095		probably benign	Het

Other mutations in Fbxo41

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Fbxo41	APN	6	85478102	splice site	probably null
IGL00919:Fbxo41	APN	6	85478570	missense	probably damaging	1.00
IGL01135:Fbxo41	APN	6	85477908	missense	probably benign	0.41
IGL02084:Fbxo41	APN	6	85480765	critical splice donor site	probably null
IGL02343:Fbxo41	APN	6	85478171	missense	possibly damaging	0.78
IGL03284:Fbxo41	APN	6	85479765	missense	probably damaging	1.00
R0116:Fbxo41	UTSW	6	85477908	missense	probably damaging	1.00
R0452:Fbxo41	UTSW	6	85478182	missense	probably damaging	1.00
R2064:Fbxo41	UTSW	6	85478471	nonsense	probably null
R2065:Fbxo41	UTSW	6	85478471	nonsense	probably null
R2067:Fbxo41	UTSW	6	85478471	nonsense	probably null
R3433:Fbxo41	UTSW	6	85477631	missense	probably damaging	1.00
R3522:Fbxo41	UTSW	6	85484181	missense	probably benign	0.00
R4086:Fbxo41	UTSW	6	85478546	missense	possibly damaging	0.93
R4521:Fbxo41	UTSW	6	85484042	missense	probably damaging	1.00
R4522:Fbxo41	UTSW	6	85484042	missense	probably damaging	1.00
R4523:Fbxo41	UTSW	6	85484042	missense	probably damaging	1.00
R4524:Fbxo41	UTSW	6	85484042	missense	probably damaging	1.00
R4867:Fbxo41	UTSW	6	85475194	missense	probably benign
R4970:Fbxo41	UTSW	6	85477924	missense	probably damaging	1.00
R5000:Fbxo41	UTSW	6	85483919	missense	probably damaging	0.98
R5112:Fbxo41	UTSW	6	85477924	missense	probably damaging	1.00
R5330:Fbxo41	UTSW	6	85479906	missense	probably benign
R5331:Fbxo41	UTSW	6	85479906	missense	probably benign
R5334:Fbxo41	UTSW	6	85478483	missense	probably damaging	1.00
R5595:Fbxo41	UTSW	6	85479901	missense	probably benign	0.00
R5632:Fbxo41	UTSW	6	85484504	missense	probably damaging	1.00
R5698:Fbxo41	UTSW	6	85477656	missense	possibly damaging	0.88
R5801:Fbxo41	UTSW	6	85484533	missense	probably damaging	0.97
R5854:Fbxo41	UTSW	6	85475094	missense	probably damaging	1.00
R6258:Fbxo41	UTSW	6	85478555	missense	probably damaging	1.00
R6260:Fbxo41	UTSW	6	85478555	missense	probably damaging	1.00
R6615:Fbxo41	UTSW	6	85478523	missense	possibly damaging	0.60
R7061:Fbxo41	UTSW	6	85475466	missense	probably benign	0.36
R7353:Fbxo41	UTSW	6	85479976	missense	possibly damaging	0.71
R7681:Fbxo41	UTSW	6	85478479	nonsense	probably null
R8077:Fbxo41	UTSW	6	85473229	missense	probably damaging	0.98
R8801:Fbxo41	UTSW	6	85484681	missense	probably damaging	1.00
X0024:Fbxo41	UTSW	6	85478470	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGTGAAGCCAGCAGTTCC -3'
(R):5'- AATCGAAATCCCACTCGGCG -3'

Sequencing Primer
(F):5'- AGCCAGCAGTTCCACGCTC -3'
(R):5'- AAGTCCGTGGCATCCTCTG -3'

Posted On

2015-08-18