Incidental Mutation 'R4520:Fbxo41'
ID334173
Institutional Source Beutler Lab
Gene Symbol Fbxo41
Ensembl Gene ENSMUSG00000047013
Gene NameF-box protein 41
SynonymsD6Ertd538e
MMRRC Submission 041763-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R4520 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location85469574-85502994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85484042 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 228 (I228T)
Ref Sequence ENSEMBL: ENSMUSP00000124754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159062] [ENSMUST00000161078] [ENSMUST00000161546]
Predicted Effect probably damaging
Transcript: ENSMUST00000159062
AA Change: I228T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125671
Gene: ENSMUSG00000047013
AA Change: I228T

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161078
AA Change: I228T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124524
Gene: ENSMUSG00000047013
AA Change: I228T

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161546
AA Change: I228T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124754
Gene: ENSMUSG00000047013
AA Change: I228T

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
Pfam:F-box-like 554 593 5.6e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Meta Mutation Damage Score 0.2564 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which is characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one of the four subunits of the SCF ubiquitin protein ligase complex that plays a role in phosphorylation-dependent ubiquitination. F-box proteins are divided into three classes depending on the interaction substrate domain each contains in addition to the F-box motif: FBXW proteins contain WD-40 domains, FBXL proteins contain leucine-rich repeats, and FBXO proteins contain either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the FBXO class. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality and premature death by 10 weeks, growth retardation, abnormal gait, dragging hindlimbs, ataxia, impaired balance, impaired coordination, tremors and abnormal neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,266 T1739A probably damaging Het
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cel C T 2: 28,557,968 V349M probably benign Het
Cspp1 A G 1: 10,134,227 T1127A probably benign Het
Cyp2b10 T C 7: 25,911,557 V113A probably benign Het
Cyp2c50 A G 19: 40,090,689 T159A probably benign Het
Degs1 T C 1: 182,276,808 D304G possibly damaging Het
Esr2 G A 12: 76,167,549 P43S possibly damaging Het
Gm5444 A G 13: 4,834,226 noncoding transcript Het
Golga3 T A 5: 110,203,751 L790* probably null Het
Gtpbp6 T C 5: 110,107,859 T105A probably benign Het
Ido2 T C 8: 24,576,178 E24G probably damaging Het
Ihh T A 1: 74,950,950 I89F probably damaging Het
Krt13 A G 11: 100,119,348 M269T probably damaging Het
Marf1 T C 16: 14,132,666 H952R probably damaging Het
Mga T A 2: 119,948,098 F2041L possibly damaging Het
Msmo1 A C 8: 64,720,523 probably benign Het
Mterf1a A G 5: 3,890,992 V292A probably damaging Het
Naxe A G 3: 88,057,982 probably null Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfr1097 T C 2: 86,891,019 D52G probably benign Het
Olfr572 A T 7: 102,928,557 I310F probably benign Het
Olfr657 T A 7: 104,636,169 V165E probably damaging Het
Otog T A 7: 46,241,053 probably benign Het
Pigo A T 4: 43,020,301 H880Q probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Pole T A 5: 110,297,924 D555E probably damaging Het
Prkag2 A G 5: 24,866,171 V403A probably damaging Het
Psg28 T A 7: 18,422,901 M470L probably benign Het
Rpgrip1 A G 14: 52,152,289 T1138A probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9c T C 13: 33,151,857 probably null Het
Sh2d6 T C 6: 72,518,953 N101D possibly damaging Het
Shisa8 C G 15: 82,211,962 V151L possibly damaging Het
Slc13a1 T C 6: 24,134,513 T124A probably benign Het
Slc6a3 G A 13: 73,540,856 V100M possibly damaging Het
Sspn A G 6: 145,961,307 T79A probably benign Het
Tlr8 C T X: 167,243,175 R893H probably damaging Het
Tnrc18 T C 5: 142,732,150 K2183R unknown Het
Trim15 T C 17: 36,866,350 I139M probably benign Het
Trmt13 A T 3: 116,581,613 probably null Het
Vmn2r84 T A 10: 130,386,522 T610S probably damaging Het
Zcchc14 A T 8: 121,609,095 probably benign Het
Other mutations in Fbxo41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fbxo41 APN 6 85478102 splice site probably null
IGL00919:Fbxo41 APN 6 85478570 missense probably damaging 1.00
IGL01135:Fbxo41 APN 6 85477908 missense probably benign 0.41
IGL02084:Fbxo41 APN 6 85480765 critical splice donor site probably null
IGL02343:Fbxo41 APN 6 85478171 missense possibly damaging 0.78
IGL03284:Fbxo41 APN 6 85479765 missense probably damaging 1.00
R0116:Fbxo41 UTSW 6 85477908 missense probably damaging 1.00
R0452:Fbxo41 UTSW 6 85478182 missense probably damaging 1.00
R2064:Fbxo41 UTSW 6 85478471 nonsense probably null
R2065:Fbxo41 UTSW 6 85478471 nonsense probably null
R2067:Fbxo41 UTSW 6 85478471 nonsense probably null
R3433:Fbxo41 UTSW 6 85477631 missense probably damaging 1.00
R3522:Fbxo41 UTSW 6 85484181 missense probably benign 0.00
R4086:Fbxo41 UTSW 6 85478546 missense possibly damaging 0.93
R4521:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4522:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4523:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4524:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4867:Fbxo41 UTSW 6 85475194 missense probably benign
R4970:Fbxo41 UTSW 6 85477924 missense probably damaging 1.00
R5000:Fbxo41 UTSW 6 85483919 missense probably damaging 0.98
R5112:Fbxo41 UTSW 6 85477924 missense probably damaging 1.00
R5330:Fbxo41 UTSW 6 85479906 missense probably benign
R5331:Fbxo41 UTSW 6 85479906 missense probably benign
R5334:Fbxo41 UTSW 6 85478483 missense probably damaging 1.00
R5595:Fbxo41 UTSW 6 85479901 missense probably benign 0.00
R5632:Fbxo41 UTSW 6 85484504 missense probably damaging 1.00
R5698:Fbxo41 UTSW 6 85477656 missense possibly damaging 0.88
R5801:Fbxo41 UTSW 6 85484533 missense probably damaging 0.97
R5854:Fbxo41 UTSW 6 85475094 missense probably damaging 1.00
R6258:Fbxo41 UTSW 6 85478555 missense probably damaging 1.00
R6260:Fbxo41 UTSW 6 85478555 missense probably damaging 1.00
R6615:Fbxo41 UTSW 6 85478523 missense possibly damaging 0.60
R7061:Fbxo41 UTSW 6 85475466 missense probably benign 0.36
R7353:Fbxo41 UTSW 6 85479976 missense possibly damaging 0.71
R7681:Fbxo41 UTSW 6 85478479 nonsense probably null
R8077:Fbxo41 UTSW 6 85473229 missense probably damaging 0.98
R8801:Fbxo41 UTSW 6 85484681 missense probably damaging 1.00
X0024:Fbxo41 UTSW 6 85478470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTGAAGCCAGCAGTTCC -3'
(R):5'- AATCGAAATCCCACTCGGCG -3'

Sequencing Primer
(F):5'- AGCCAGCAGTTCCACGCTC -3'
(R):5'- AAGTCCGTGGCATCCTCTG -3'
Posted On2015-08-18