Incidental Mutation 'R4520:Cyp2b10'
ID334176
Institutional Source Beutler Lab
Gene Symbol Cyp2b10
Ensembl Gene ENSMUSG00000030483
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 10
Synonymsphenobarbitol inducible, type b, p16, Cyp2b20, Cyp2b
MMRRC Submission 041763-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4520 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location25897620-25926624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25911557 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 113 (V113A)
Ref Sequence ENSEMBL: ENSMUSP00000072264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005477] [ENSMUST00000072438]
Predicted Effect probably benign
Transcript: ENSMUST00000005477
AA Change: V113A

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000005477
Gene: ENSMUSG00000030483
AA Change: V113A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 497 4.1e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072438
AA Change: V113A

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000072264
Gene: ENSMUSG00000030483
AA Change: V113A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 488 2e-152 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP2B6, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to metabolize some xenobiotics, such as the anti-cancer drugs cyclophosphamide and ifosphamide. Transcript variants for this gene have been described; however, it has not been resolved whether these transcripts are in fact produced by this gene or by a closely related pseudogene, CYP2B7. Both the gene and the pseudogene are located in the middle of a CYP2A pseudogene found in a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,266 T1739A probably damaging Het
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cel C T 2: 28,557,968 V349M probably benign Het
Cspp1 A G 1: 10,134,227 T1127A probably benign Het
Cyp2c50 A G 19: 40,090,689 T159A probably benign Het
Degs1 T C 1: 182,276,808 D304G possibly damaging Het
Esr2 G A 12: 76,167,549 P43S possibly damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Gm5444 A G 13: 4,834,226 noncoding transcript Het
Golga3 T A 5: 110,203,751 L790* probably null Het
Gtpbp6 T C 5: 110,107,859 T105A probably benign Het
Ido2 T C 8: 24,576,178 E24G probably damaging Het
Ihh T A 1: 74,950,950 I89F probably damaging Het
Krt13 A G 11: 100,119,348 M269T probably damaging Het
Marf1 T C 16: 14,132,666 H952R probably damaging Het
Mga T A 2: 119,948,098 F2041L possibly damaging Het
Msmo1 A C 8: 64,720,523 probably benign Het
Mterf1a A G 5: 3,890,992 V292A probably damaging Het
Naxe A G 3: 88,057,982 probably null Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfr1097 T C 2: 86,891,019 D52G probably benign Het
Olfr572 A T 7: 102,928,557 I310F probably benign Het
Olfr657 T A 7: 104,636,169 V165E probably damaging Het
Otog T A 7: 46,241,053 probably benign Het
Pigo A T 4: 43,020,301 H880Q probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Pole T A 5: 110,297,924 D555E probably damaging Het
Prkag2 A G 5: 24,866,171 V403A probably damaging Het
Psg28 T A 7: 18,422,901 M470L probably benign Het
Rpgrip1 A G 14: 52,152,289 T1138A probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9c T C 13: 33,151,857 probably null Het
Sh2d6 T C 6: 72,518,953 N101D possibly damaging Het
Shisa8 C G 15: 82,211,962 V151L possibly damaging Het
Slc13a1 T C 6: 24,134,513 T124A probably benign Het
Slc6a3 G A 13: 73,540,856 V100M possibly damaging Het
Sspn A G 6: 145,961,307 T79A probably benign Het
Tlr8 C T X: 167,243,175 R893H probably damaging Het
Tnrc18 T C 5: 142,732,150 K2183R unknown Het
Trim15 T C 17: 36,866,350 I139M probably benign Het
Trmt13 A T 3: 116,581,613 probably null Het
Vmn2r84 T A 10: 130,386,522 T610S probably damaging Het
Zcchc14 A T 8: 121,609,095 probably benign Het
Other mutations in Cyp2b10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Cyp2b10 APN 7 25913937 missense probably damaging 0.99
IGL02341:Cyp2b10 APN 7 25911242 missense probably benign 0.33
IGL02557:Cyp2b10 APN 7 25914881 missense probably benign
R0038:Cyp2b10 UTSW 7 25914862 missense probably benign 0.21
R0393:Cyp2b10 UTSW 7 25914934 splice site probably benign
R0569:Cyp2b10 UTSW 7 25897735 missense probably damaging 1.00
R1035:Cyp2b10 UTSW 7 25917048 missense probably benign 0.34
R1262:Cyp2b10 UTSW 7 25915411 missense probably benign 0.16
R1282:Cyp2b10 UTSW 7 25926080 missense probably damaging 1.00
R1452:Cyp2b10 UTSW 7 25925388 intron probably benign
R2163:Cyp2b10 UTSW 7 25925385 intron probably benign
R4831:Cyp2b10 UTSW 7 25915496 nonsense probably null
R5201:Cyp2b10 UTSW 7 25916994 missense probably damaging 1.00
R5330:Cyp2b10 UTSW 7 25913989 nonsense probably null
R5586:Cyp2b10 UTSW 7 25917012 missense probably damaging 1.00
R5964:Cyp2b10 UTSW 7 25926223 missense probably benign 0.28
R6043:Cyp2b10 UTSW 7 25917339 missense probably damaging 0.99
R6470:Cyp2b10 UTSW 7 25911656 missense possibly damaging 0.57
R6991:Cyp2b10 UTSW 7 25917355 missense probably benign 0.05
R7567:Cyp2b10 UTSW 7 25914779 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTTGCTGTCGTTGAGCC -3'
(R):5'- GCCTGTACACTCATGTCTCG -3'

Sequencing Primer
(F):5'- GTCGTTGAGCCAACCTTCAAG -3'
(R):5'- GTACACTCATGTCTCGGCTTTG -3'
Posted On2015-08-18