Incidental Mutation 'R4520:Esr2'
ID334189
Institutional Source Beutler Lab
Gene Symbol Esr2
Ensembl Gene ENSMUSG00000021055
Gene Nameestrogen receptor 2 (beta)
SynonymsERbeta, ER beta, Estrb, oestrogen receptor beta
MMRRC Submission 041763-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock #R4520 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location76120419-76177259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76167549 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 43 (P43S)
Ref Sequence ENSEMBL: ENSMUSP00000075932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076634] [ENSMUST00000101291] [ENSMUST00000110421] [ENSMUST00000133564] [ENSMUST00000218621]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076634
AA Change: P43S

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075932
Gene: ENSMUSG00000021055
AA Change: P43S

DomainStartEndE-ValueType
Pfam:ERbeta_N 31 143 4.2e-41 PFAM
ZnF_C4 165 236 1.84e-34 SMART
HOLI 319 488 5.99e-34 SMART
Blast:HOLI 489 519 7e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000101291
AA Change: P24S

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098849
Gene: ENSMUSG00000021055
AA Change: P24S

DomainStartEndE-ValueType
Pfam:ERbeta_N 31 141 1.9e-56 PFAM
ZnF_C4 165 236 1.84e-34 SMART
HOLI 319 506 6.88e-34 SMART
Blast:HOLI 507 537 8e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000110421
AA Change: P24S

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106051
Gene: ENSMUSG00000021055
AA Change: P24S

DomainStartEndE-ValueType
Pfam:ERbeta_N 31 143 4.2e-41 PFAM
ZnF_C4 165 236 1.84e-34 SMART
HOLI 319 488 5.99e-34 SMART
Blast:HOLI 489 519 7e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000133564
AA Change: P24S

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138637
Gene: ENSMUSG00000021055
AA Change: P24S

DomainStartEndE-ValueType
Pfam:ERbeta_N 31 143 1.1e-41 PFAM
ZnF_C4 165 236 1.84e-34 SMART
PDB:2J7Y|A 274 337 1e-33 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000218621
AA Change: P43S

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of estrogen receptors and superfamily of nuclear receptor transcription factors. The gene product contains an N-terminal DNA binding domain and C-terminal ligand binding domain and is localized to the nucleus, cytoplasm, and mitochondria. Upon binding to 17beta-estradiol or related ligands, the encoded protein forms homo- or hetero-dimers that interact with specific DNA sequences to activate transcription. Some isoforms dominantly inhibit the activity of other estrogen receptor family members. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neural, behavior, glucose homeostasis, sex-specific nociception, cardiac, and ion channel abnormalities and myeloproliferative disorders. Females are sterile/subfertile with granulosa cell defects; males show prostate hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,266 T1739A probably damaging Het
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cel C T 2: 28,557,968 V349M probably benign Het
Cspp1 A G 1: 10,134,227 T1127A probably benign Het
Cyp2b10 T C 7: 25,911,557 V113A probably benign Het
Cyp2c50 A G 19: 40,090,689 T159A probably benign Het
Degs1 T C 1: 182,276,808 D304G possibly damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Gm5444 A G 13: 4,834,226 noncoding transcript Het
Golga3 T A 5: 110,203,751 L790* probably null Het
Gtpbp6 T C 5: 110,107,859 T105A probably benign Het
Ido2 T C 8: 24,576,178 E24G probably damaging Het
Ihh T A 1: 74,950,950 I89F probably damaging Het
Krt13 A G 11: 100,119,348 M269T probably damaging Het
Marf1 T C 16: 14,132,666 H952R probably damaging Het
Mga T A 2: 119,948,098 F2041L possibly damaging Het
Msmo1 A C 8: 64,720,523 probably benign Het
Mterf1a A G 5: 3,890,992 V292A probably damaging Het
Naxe A G 3: 88,057,982 probably null Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfr1097 T C 2: 86,891,019 D52G probably benign Het
Olfr572 A T 7: 102,928,557 I310F probably benign Het
Olfr657 T A 7: 104,636,169 V165E probably damaging Het
Otog T A 7: 46,241,053 probably benign Het
Pigo A T 4: 43,020,301 H880Q probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Pole T A 5: 110,297,924 D555E probably damaging Het
Prkag2 A G 5: 24,866,171 V403A probably damaging Het
Psg28 T A 7: 18,422,901 M470L probably benign Het
Rpgrip1 A G 14: 52,152,289 T1138A probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9c T C 13: 33,151,857 probably null Het
Sh2d6 T C 6: 72,518,953 N101D possibly damaging Het
Shisa8 C G 15: 82,211,962 V151L possibly damaging Het
Slc13a1 T C 6: 24,134,513 T124A probably benign Het
Slc6a3 G A 13: 73,540,856 V100M possibly damaging Het
Sspn A G 6: 145,961,307 T79A probably benign Het
Tlr8 C T X: 167,243,175 R893H probably damaging Het
Tnrc18 T C 5: 142,732,150 K2183R unknown Het
Trim15 T C 17: 36,866,350 I139M probably benign Het
Trmt13 A T 3: 116,581,613 probably null Het
Vmn2r84 T A 10: 130,386,522 T610S probably damaging Het
Zcchc14 A T 8: 121,609,095 probably benign Het
Other mutations in Esr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Esr2 APN 12 76133896 missense probably damaging 1.00
IGL00435:Esr2 APN 12 76133879 missense probably damaging 1.00
IGL01591:Esr2 APN 12 76121724 utr 3 prime probably benign
IGL01695:Esr2 APN 12 76145319 missense probably damaging 1.00
IGL02142:Esr2 APN 12 76123195 missense probably benign 0.02
IGL02343:Esr2 APN 12 76145345 missense probably benign 0.01
IGL02584:Esr2 APN 12 76145262 missense probably damaging 1.00
R0380:Esr2 UTSW 12 76123291 missense possibly damaging 0.81
R0975:Esr2 UTSW 12 76145308 missense possibly damaging 0.49
R2075:Esr2 UTSW 12 76165447 critical splice donor site probably null
R3881:Esr2 UTSW 12 76167620 missense probably damaging 0.96
R4475:Esr2 UTSW 12 76133942 missense probably benign 0.04
R4636:Esr2 UTSW 12 76123324 missense possibly damaging 0.50
R5167:Esr2 UTSW 12 76123274 missense probably benign 0.00
R6163:Esr2 UTSW 12 76121869 missense probably damaging 1.00
R6928:Esr2 UTSW 12 76165478 missense probably damaging 1.00
R6965:Esr2 UTSW 12 76121857 missense probably damaging 0.97
R7441:Esr2 UTSW 12 76141394 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGAAGTTGGCCATAGCAC -3'
(R):5'- ACTTCTTAGTTACTCCGGCAG -3'

Sequencing Primer
(F):5'- CCAGAAGTTGGCCATAGCACATTTG -3'
(R):5'- CGGCAGCTTGAACTAACTGGATATC -3'
Posted On2015-08-18