Incidental Mutation 'R4521:Dcaf6'
ID334203
Institutional Source Beutler Lab
Gene Symbol Dcaf6
Ensembl Gene ENSMUSG00000026571
Gene NameDDB1 and CUL4 associated factor 6
SynonymsPC326, 1200006M05Rik, Iqwd1
MMRRC Submission 041764-MU
Accession Numbers

Genbank: NM_028759; MGI: 1921356

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4521 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location165328698-165460475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 165390490 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 347 (D347E)
Ref Sequence ENSEMBL: ENSMUSP00000027856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027856]
Predicted Effect probably damaging
Transcript: ENSMUST00000027856
AA Change: D347E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027856
Gene: ENSMUSG00000026571
AA Change: D347E

DomainStartEndE-ValueType
WD40 40 79 5.77e-5 SMART
WD40 82 124 1.2e-2 SMART
WD40 130 170 2.15e-1 SMART
WD40 184 220 3.33e-1 SMART
WD40 238 281 6.66e-1 SMART
low complexity region 364 374 N/A INTRINSIC
low complexity region 499 510 N/A INTRINSIC
low complexity region 669 676 N/A INTRINSIC
IQ 691 713 1.25e1 SMART
WD40 722 763 3.84e0 SMART
WD40 766 805 1.22e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194869
Predicted Effect probably benign
Transcript: ENSMUST00000195220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195686
Meta Mutation Damage Score 0.0633 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Bora G T 14: 99,068,548 S451I probably damaging Het
Cadm3 A T 1: 173,345,063 probably null Het
Car14 A G 3: 95,904,378 probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdc20b A G 13: 113,081,191 I381M probably damaging Het
Col12a1 C T 9: 79,633,357 V2449I probably benign Het
Crb2 T C 2: 37,795,337 probably benign Het
Dlgap2 G A 8: 14,727,871 R372H probably damaging Het
Fat3 T C 9: 15,922,942 N4118S probably null Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fpr2 A C 17: 17,893,247 R168S probably benign Het
Ghr A G 15: 3,325,958 I281T probably damaging Het
Glmp C A 3: 88,328,039 N259K possibly damaging Het
Grhl3 T C 4: 135,546,250 K564E probably damaging Het
Helz2 T C 2: 181,228,833 H2875R probably benign Het
Lcp1 A G 14: 75,215,168 D438G possibly damaging Het
Lrfn2 T A 17: 49,069,894 M1K probably null Het
Lrp6 A G 6: 134,485,862 C612R probably damaging Het
Map3k13 T C 16: 21,905,775 V341A possibly damaging Het
Megf8 T A 7: 25,342,701 C1315S probably benign Het
Mrgpra9 A T 7: 47,235,190 L243H probably damaging Het
Mrgprx1 T C 7: 48,021,699 D100G probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nup93 T C 8: 94,314,636 Y801H probably damaging Het
Olfr623 C T 7: 103,660,332 R306H probably benign Het
Olfr810 T A 10: 129,791,181 N136I possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Plpp2 A G 10: 79,530,625 Y118H probably damaging Het
Ppwd1 A G 13: 104,209,659 V496A probably benign Het
Rbm20 A G 19: 53,817,202 N466S probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Skida1 T C 2: 18,045,872 probably benign Het
Stk17b A G 1: 53,764,038 Y73H probably damaging Het
Tapbpl A G 6: 125,228,122 I287T probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Topbp1 T C 9: 103,334,202 probably benign Het
Tsen54 G A 11: 115,817,106 probably null Het
Ttn G A 2: 76,725,216 R28736* probably null Het
Wdr36 G A 18: 32,841,148 probably null Het
Other mutations in Dcaf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00828:Dcaf6 APN 1 165338347 splice site probably benign
IGL01377:Dcaf6 APN 1 165388724 missense probably benign 0.01
IGL02027:Dcaf6 APN 1 165424341 missense probably damaging 1.00
IGL02390:Dcaf6 APN 1 165422921 missense possibly damaging 0.50
IGL02754:Dcaf6 APN 1 165338346 critical splice acceptor site probably null
IGL02900:Dcaf6 APN 1 165399775 missense probably damaging 1.00
IGL03119:Dcaf6 APN 1 165339976 missense probably damaging 1.00
IGL03211:Dcaf6 APN 1 165422933 missense possibly damaging 0.55
R0588:Dcaf6 UTSW 1 165420223 missense possibly damaging 0.89
R1494:Dcaf6 UTSW 1 165333373 missense probably damaging 0.99
R1512:Dcaf6 UTSW 1 165352020 missense probably benign 0.22
R1840:Dcaf6 UTSW 1 165399748 missense probably damaging 0.96
R2191:Dcaf6 UTSW 1 165422864 missense probably benign 0.07
R2297:Dcaf6 UTSW 1 165399862 missense probably damaging 1.00
R3082:Dcaf6 UTSW 1 165422852 splice site probably benign
R3861:Dcaf6 UTSW 1 165429269 missense probably damaging 1.00
R3907:Dcaf6 UTSW 1 165424380 nonsense probably null
R4531:Dcaf6 UTSW 1 165411467 missense probably damaging 1.00
R4906:Dcaf6 UTSW 1 165411463 critical splice donor site probably null
R4916:Dcaf6 UTSW 1 165420205 missense probably damaging 1.00
R4956:Dcaf6 UTSW 1 165388785 missense probably benign 0.00
R5080:Dcaf6 UTSW 1 165420121 missense probably damaging 1.00
R5091:Dcaf6 UTSW 1 165330003 missense possibly damaging 0.76
R5277:Dcaf6 UTSW 1 165424346 missense probably benign 0.09
R5512:Dcaf6 UTSW 1 165399835 missense possibly damaging 0.84
R5914:Dcaf6 UTSW 1 165351155 missense probably benign
R6004:Dcaf6 UTSW 1 165388685 missense probably benign 0.00
R6239:Dcaf6 UTSW 1 165351270 missense possibly damaging 0.47
R6736:Dcaf6 UTSW 1 165399785 missense possibly damaging 0.77
R7051:Dcaf6 UTSW 1 165424317 missense possibly damaging 0.82
R7110:Dcaf6 UTSW 1 165351968 missense probably benign 0.22
R7583:Dcaf6 UTSW 1 165333310 missense probably damaging 1.00
R7776:Dcaf6 UTSW 1 165352054 nonsense probably null
R7790:Dcaf6 UTSW 1 165399715 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAAATAAAATAACACGCGGACCAG -3'
(R):5'- TGTGATGGGACTCTGATAACTTT -3'

Sequencing Primer
(F):5'- GCGGACCAGCCACACAAAATC -3'
(R):5'- TGATGGGACTCTGATAACTTTTTATC -3'
Posted On2015-08-18