Mutagenetix > Incidental Mutation

Incidental Mutation 'R4521:Orc4'

334207

Institutional Source

Beutler Lab

Gene Symbol

Orc4

Ensembl Gene

ENSMUSG00000026761

Gene Name

origin recognition complex, subunit 4

Synonyms

mMmORC4, Orc4, Orc4l, Orc4P

MMRRC Submission

041764-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R4521 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48902824-48950277 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 48937489 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 31 (P31S)

Ref Sequence

ENSEMBL: ENSMUSP00000088497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028098] [ENSMUST00000090976] [ENSMUST00000123271] [ENSMUST00000142851] [ENSMUST00000149679]

AlphaFold

O88708

Predicted Effect

probably benign
Transcript: ENSMUST00000028098
AA Change: P31S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028098
Gene: ENSMUSG00000026761
AA Change: P31S

Domain	Start	End	E-Value	Type
AAA	57	199	2.75e-5	SMART
Pfam:ORC4_C	225	413	1.3e-51	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000090976
AA Change: P31S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000088497
Gene: ENSMUSG00000026761
AA Change: P31S

Domain	Start	End	E-Value	Type
Pfam:AAA_16	34	138	3.3e-14	PFAM
Pfam:KAP_NTPase	38	123	2.9e-7	PFAM
Pfam:Arch_ATPase	43	130	4.5e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123271
AA Change: P31S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123789

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123809

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141441

Predicted Effect

probably benign
Transcript: ENSMUST00000142851
AA Change: P31S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000119274
Gene: ENSMUSG00000026761
AA Change: P31S

Domain	Start	End	E-Value	Type
AAA	57	199	2.75e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149679
AA Change: P31S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000121114
Gene: ENSMUSG00000026761
AA Change: P31S

Domain	Start	End	E-Value	Type
SCOP:d1jbka_	43	73	2e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153150

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154784

Meta Mutation Damage Score

0.0618

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. This gene encodes a subunit of the ORC complex. Several alternatively spliced transcript variants, some of which encode the same protein, have been reported for this gene. [provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	A	G	10: 50,660,670	N700D	probably benign	Het
Bora	G	T	14: 99,068,548	S451I	probably damaging	Het
Cadm3	A	T	1: 173,345,063		probably null	Het
Car14	A	G	3: 95,904,378		probably benign	Het
Ccdc88c	G	T	12: 100,913,332	S1843R	possibly damaging	Het
Cdc20b	A	G	13: 113,081,191	I381M	probably damaging	Het
Col12a1	C	T	9: 79,633,357	V2449I	probably benign	Het
Crb2	T	C	2: 37,795,337		probably benign	Het
Dcaf6	A	T	1: 165,390,490	D347E	probably damaging	Het
Dlgap2	G	A	8: 14,727,871	R372H	probably damaging	Het
Fat3	T	C	9: 15,922,942	N4118S	probably null	Het
Fbxo41	A	G	6: 85,484,042	I228T	probably damaging	Het
Fpr2	A	C	17: 17,893,247	R168S	probably benign	Het
Ghr	A	G	15: 3,325,958	I281T	probably damaging	Het
Glmp	C	A	3: 88,328,039	N259K	possibly damaging	Het
Grhl3	T	C	4: 135,546,250	K564E	probably damaging	Het
Helz2	T	C	2: 181,228,833	H2875R	probably benign	Het
Lcp1	A	G	14: 75,215,168	D438G	possibly damaging	Het
Lrfn2	T	A	17: 49,069,894	M1K	probably null	Het
Lrp6	A	G	6: 134,485,862	C612R	probably damaging	Het
Map3k13	T	C	16: 21,905,775	V341A	possibly damaging	Het
Megf8	T	A	7: 25,342,701	C1315S	probably benign	Het
Mrgpra9	A	T	7: 47,235,190	L243H	probably damaging	Het
Mrgprx1	T	C	7: 48,021,699	D100G	probably benign	Het
Nop2	G	T	6: 125,133,552	R47L	probably damaging	Het
Nup93	T	C	8: 94,314,636	Y801H	probably damaging	Het
Olfr623	C	T	7: 103,660,332	R306H	probably benign	Het
Olfr810	T	A	10: 129,791,181	N136I	possibly damaging	Het
Plce1	T	C	19: 38,524,319	S21P	possibly damaging	Het
Plpp2	A	G	10: 79,530,625	Y118H	probably damaging	Het
Ppwd1	A	G	13: 104,209,659	V496A	probably benign	Het
Rbm20	A	G	19: 53,817,202	N466S	probably benign	Het
Rpl10l	T	C	12: 66,283,738	D207G	probably benign	Het
Skida1	T	C	2: 18,045,872		probably benign	Het
Stk17b	A	G	1: 53,764,038	Y73H	probably damaging	Het
Tapbpl	A	G	6: 125,228,122	I287T	probably damaging	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Topbp1	T	C	9: 103,334,202		probably benign	Het
Tsen54	G	A	11: 115,817,106		probably null	Het
Ttn	G	A	2: 76,725,216	R28736*	probably null	Het
Wdr36	G	A	18: 32,841,148		probably null	Het

Other mutations in Orc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00928:Orc4	APN	2	48910269	missense	probably benign
IGL01523:Orc4	APN	2	48917224	missense	probably benign	0.00
IGL02546:Orc4	APN	2	48917284	missense	probably null	0.02
IGL02592:Orc4	APN	2	48933078	critical splice donor site	probably null
R0277:Orc4	UTSW	2	48937467	missense	possibly damaging	0.78
R0323:Orc4	UTSW	2	48937467	missense	possibly damaging	0.78
R0554:Orc4	UTSW	2	48905421	missense	probably benign	0.01
R0573:Orc4	UTSW	2	48917273	missense	probably benign	0.05
R0788:Orc4	UTSW	2	48937467	missense	possibly damaging	0.78
R0893:Orc4	UTSW	2	48932610	unclassified	probably benign
R1112:Orc4	UTSW	2	48933572	missense	probably damaging	0.97
R1466:Orc4	UTSW	2	48909494	missense	possibly damaging	0.91
R1466:Orc4	UTSW	2	48909494	missense	possibly damaging	0.91
R1584:Orc4	UTSW	2	48909494	missense	possibly damaging	0.91
R1868:Orc4	UTSW	2	48910293	missense	probably benign	0.07
R2342:Orc4	UTSW	2	48927140	missense	probably damaging	0.99
R2370:Orc4	UTSW	2	48933099	missense	probably benign	0.01
R3085:Orc4	UTSW	2	48937489	missense	probably benign	0.01
R3086:Orc4	UTSW	2	48937489	missense	probably benign	0.01
R3122:Orc4	UTSW	2	48937489	missense	probably benign	0.01
R3404:Orc4	UTSW	2	48937489	missense	probably benign	0.01
R3551:Orc4	UTSW	2	48937489	missense	probably benign	0.01
R4199:Orc4	UTSW	2	48937489	missense	probably benign	0.01
R4515:Orc4	UTSW	2	48937489	missense	probably benign	0.01
R4518:Orc4	UTSW	2	48937489	missense	probably benign	0.01
R4519:Orc4	UTSW	2	48937489	missense	probably benign	0.01
R4523:Orc4	UTSW	2	48937489	missense	probably benign	0.01
R4529:Orc4	UTSW	2	48937489	missense	probably benign	0.01
R4532:Orc4	UTSW	2	48937489	missense	probably benign	0.01
R4533:Orc4	UTSW	2	48937489	missense	probably benign	0.01
R4652:Orc4	UTSW	2	48936750	unclassified	probably benign
R4845:Orc4	UTSW	2	48909466	missense	probably benign	0.07
R5893:Orc4	UTSW	2	48905547	nonsense	probably null
R6708:Orc4	UTSW	2	48937493	missense	probably benign	0.00
R6972:Orc4	UTSW	2	48927184	missense	probably benign	0.03
R7572:Orc4	UTSW	2	48910236	missense	probably benign	0.01
R7938:Orc4	UTSW	2	48910191	missense	possibly damaging	0.79
R9267:Orc4	UTSW	2	48937522	nonsense	probably null
R9463:Orc4	UTSW	2	48936771	critical splice donor site	probably null
R9472:Orc4	UTSW	2	48905551	missense	probably benign	0.03
R9480:Orc4	UTSW	2	48905551	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ACCAGGTGTTAAGTACCAGAATTC -3'
(R):5'- AGTTCTGCCATTCACTGACG -3'

Sequencing Primer
(F):5'- ACCAGAATTCTTTCAATAATAGCAGG -3'
(R):5'- GACGTGACATCTCATTATTTACCTG -3'

Posted On

2015-08-18