Incidental Mutation 'R4521:Car14'
List |< first << previous [record 4 of 42] next >> last >|
ID334211
Institutional Source Beutler Lab
Gene Symbol Car14
Ensembl Gene ENSMUSG00000038526
Gene Namecarbonic anhydrase 14
SynonymsCA XIV
MMRRC Submission 041764-MU
Accession Numbers

Genbank: NM_011797; MGI: 1344341

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4521 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95897768-95904691 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 95904378 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036181] [ENSMUST00000147962]
Predicted Effect probably benign
Transcript: ENSMUST00000036181
SMART Domains Protein: ENSMUSP00000036983
Gene: ENSMUSG00000038526

DomainStartEndE-ValueType
Carb_anhydrase 22 278 2.43e-123 SMART
transmembrane domain 290 312 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126722
Predicted Effect probably benign
Transcript: ENSMUST00000147962
SMART Domains Protein: ENSMUSP00000117464
Gene: ENSMUSG00000038526

DomainStartEndE-ValueType
Carb_anhydrase 8 171 1.79e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149202
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA XIV is predicted to be a type I membrane protein and shares highest sequence similarity with the other transmembrane CA isoform, CA XII; however, they have different patterns of tissue-specific expression and thus may play different physiologic roles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and display normal growth, health and fertility. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Bora G T 14: 99,068,548 S451I probably damaging Het
Cadm3 A T 1: 173,345,063 probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdc20b A G 13: 113,081,191 I381M probably damaging Het
Col12a1 C T 9: 79,633,357 V2449I probably benign Het
Crb2 T C 2: 37,795,337 probably benign Het
Dcaf6 A T 1: 165,390,490 D347E probably damaging Het
Dlgap2 G A 8: 14,727,871 R372H probably damaging Het
Fat3 T C 9: 15,922,942 N4118S probably null Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fpr2 A C 17: 17,893,247 R168S probably benign Het
Ghr A G 15: 3,325,958 I281T probably damaging Het
Glmp C A 3: 88,328,039 N259K possibly damaging Het
Grhl3 T C 4: 135,546,250 K564E probably damaging Het
Helz2 T C 2: 181,228,833 H2875R probably benign Het
Lcp1 A G 14: 75,215,168 D438G possibly damaging Het
Lrfn2 T A 17: 49,069,894 M1K probably null Het
Lrp6 A G 6: 134,485,862 C612R probably damaging Het
Map3k13 T C 16: 21,905,775 V341A possibly damaging Het
Megf8 T A 7: 25,342,701 C1315S probably benign Het
Mrgpra9 A T 7: 47,235,190 L243H probably damaging Het
Mrgprx1 T C 7: 48,021,699 D100G probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nup93 T C 8: 94,314,636 Y801H probably damaging Het
Olfr623 C T 7: 103,660,332 R306H probably benign Het
Olfr810 T A 10: 129,791,181 N136I possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Plpp2 A G 10: 79,530,625 Y118H probably damaging Het
Ppwd1 A G 13: 104,209,659 V496A probably benign Het
Rbm20 A G 19: 53,817,202 N466S probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Skida1 T C 2: 18,045,872 probably benign Het
Stk17b A G 1: 53,764,038 Y73H probably damaging Het
Tapbpl A G 6: 125,228,122 I287T probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Topbp1 T C 9: 103,334,202 probably benign Het
Tsen54 G A 11: 115,817,106 probably null Het
Ttn G A 2: 76,725,216 R28736* probably null Het
Wdr36 G A 18: 32,841,148 probably null Het
Other mutations in Car14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Car14 APN 3 95898816 missense probably damaging 1.00
IGL01287:Car14 APN 3 95899559 missense possibly damaging 0.68
IGL01900:Car14 APN 3 95901221 missense probably benign 0.00
IGL02402:Car14 APN 3 95899558 missense possibly damaging 0.92
IGL03152:Car14 APN 3 95898845 missense probably damaging 1.00
R0109:Car14 UTSW 3 95899451 missense probably benign 0.00
R1729:Car14 UTSW 3 95901248 missense possibly damaging 0.90
R4776:Car14 UTSW 3 95898873 missense probably benign 0.30
R5709:Car14 UTSW 3 95898988 missense possibly damaging 0.60
R6358:Car14 UTSW 3 95898175 missense possibly damaging 0.93
R6895:Car14 UTSW 3 95898160 missense probably benign
R7217:Car14 UTSW 3 95899317 missense probably damaging 1.00
R7648:Car14 UTSW 3 95898195 missense probably benign 0.01
R7763:Car14 UTSW 3 95904372 start codon destroyed probably null 0.01
X0026:Car14 UTSW 3 95899209 unclassified probably benign
X0064:Car14 UTSW 3 95901099 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTAATCGCTGGGTTAGAG -3'
(R):5'- TGGGATCCAGAAGTTCGTGTTAAC -3'

Sequencing Primer
(F):5'- AGGATCTCCTCCATAGTCTTTCTC -3'
(R):5'- CCTGTGGAAAATCAAGTCCCTGG -3'
Posted On2015-08-18