Mutagenetix > Incidental Mutation

Incidental Mutation 'R4521:Grhl3'

334213

Institutional Source

Beutler Lab

Gene Symbol

Grhl3

Ensembl Gene

ENSMUSG00000037188

Gene Name

grainyhead like transcription factor 3

Synonyms

Som, ct, Get1

MMRRC Submission

041764-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R4521 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135541888-135573630 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135546250 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 564 (K564E)

Ref Sequence

ENSEMBL: ENSMUSP00000101481 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105855]

AlphaFold

Q5FWH3

Predicted Effect

probably damaging
Transcript: ENSMUST00000105855
AA Change: K564E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101481
Gene: ENSMUSG00000037188
AA Change: K564E

Domain	Start	End	E-Value	Type
Pfam:CP2	215	421	2.5e-81	PFAM

Meta Mutation Damage Score

0.4031

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein may function as a transcription factor during development, and has been shown to stimulate migration of endothelial cells. Multiple transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for the variably penetrant curly-tail mutation (ct) show symptoms of cranial or spinal neural tube defects such as curly tails and/or spina bifida; homozygotes with more severe phenotypes display exencephaly and die in utero. Homozygous knockout mice show severe neural tube defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	A	G	10: 50,660,670	N700D	probably benign	Het
Bora	G	T	14: 99,068,548	S451I	probably damaging	Het
Cadm3	A	T	1: 173,345,063		probably null	Het
Car14	A	G	3: 95,904,378		probably benign	Het
Ccdc88c	G	T	12: 100,913,332	S1843R	possibly damaging	Het
Cdc20b	A	G	13: 113,081,191	I381M	probably damaging	Het
Col12a1	C	T	9: 79,633,357	V2449I	probably benign	Het
Crb2	T	C	2: 37,795,337		probably benign	Het
Dcaf6	A	T	1: 165,390,490	D347E	probably damaging	Het
Dlgap2	G	A	8: 14,727,871	R372H	probably damaging	Het
Fat3	T	C	9: 15,922,942	N4118S	probably null	Het
Fbxo41	A	G	6: 85,484,042	I228T	probably damaging	Het
Fpr2	A	C	17: 17,893,247	R168S	probably benign	Het
Ghr	A	G	15: 3,325,958	I281T	probably damaging	Het
Glmp	C	A	3: 88,328,039	N259K	possibly damaging	Het
Helz2	T	C	2: 181,228,833	H2875R	probably benign	Het
Lcp1	A	G	14: 75,215,168	D438G	possibly damaging	Het
Lrfn2	T	A	17: 49,069,894	M1K	probably null	Het
Lrp6	A	G	6: 134,485,862	C612R	probably damaging	Het
Map3k13	T	C	16: 21,905,775	V341A	possibly damaging	Het
Megf8	T	A	7: 25,342,701	C1315S	probably benign	Het
Mrgpra9	A	T	7: 47,235,190	L243H	probably damaging	Het
Mrgprx1	T	C	7: 48,021,699	D100G	probably benign	Het
Nop2	G	T	6: 125,133,552	R47L	probably damaging	Het
Nup93	T	C	8: 94,314,636	Y801H	probably damaging	Het
Olfr623	C	T	7: 103,660,332	R306H	probably benign	Het
Olfr810	T	A	10: 129,791,181	N136I	possibly damaging	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Plce1	T	C	19: 38,524,319	S21P	possibly damaging	Het
Plpp2	A	G	10: 79,530,625	Y118H	probably damaging	Het
Ppwd1	A	G	13: 104,209,659	V496A	probably benign	Het
Rbm20	A	G	19: 53,817,202	N466S	probably benign	Het
Rpl10l	T	C	12: 66,283,738	D207G	probably benign	Het
Skida1	T	C	2: 18,045,872		probably benign	Het
Stk17b	A	G	1: 53,764,038	Y73H	probably damaging	Het
Tapbpl	A	G	6: 125,228,122	I287T	probably damaging	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Topbp1	T	C	9: 103,334,202		probably benign	Het
Tsen54	G	A	11: 115,817,106		probably null	Het
Ttn	G	A	2: 76,725,216	R28736*	probably null	Het
Wdr36	G	A	18: 32,841,148		probably null	Het

Other mutations in Grhl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02638:Grhl3	APN	4	135556865	missense	probably benign	0.00
IGL02868:Grhl3	APN	4	135554604	missense	probably damaging	1.00
Bite-size	UTSW	4	135557433	missense	possibly damaging	0.46
hammerkop	UTSW	4	135546246	missense	probably damaging	1.00
hoopoe	UTSW	4	135559146	missense	probably benign	0.00
Tropicbird	UTSW	4	135559104	nonsense	probably null
R0121:Grhl3	UTSW	4	135552549	missense	probably damaging	0.97
R0180:Grhl3	UTSW	4	135554530	missense	probably benign	0.00
R0627:Grhl3	UTSW	4	135552681	missense	probably benign	0.18
R0727:Grhl3	UTSW	4	135546254	missense	possibly damaging	0.90
R1248:Grhl3	UTSW	4	135561306	missense	probably benign	0.01
R1664:Grhl3	UTSW	4	135552550	missense	probably benign	0.11
R2910:Grhl3	UTSW	4	135559146	missense	probably benign	0.00
R2911:Grhl3	UTSW	4	135559146	missense	probably benign	0.00
R3773:Grhl3	UTSW	4	135555847	nonsense	probably null
R4033:Grhl3	UTSW	4	135573424	start codon destroyed	probably benign
R4576:Grhl3	UTSW	4	135561251	missense	probably damaging	1.00
R4650:Grhl3	UTSW	4	135549236	splice site	probably null
R4697:Grhl3	UTSW	4	135548466	missense	probably damaging	1.00
R4919:Grhl3	UTSW	4	135559104	nonsense	probably null
R4920:Grhl3	UTSW	4	135559104	nonsense	probably null
R4961:Grhl3	UTSW	4	135552607	missense	probably damaging	1.00
R5100:Grhl3	UTSW	4	135542675	missense	probably benign
R5180:Grhl3	UTSW	4	135559104	nonsense	probably null
R5181:Grhl3	UTSW	4	135559104	nonsense	probably null
R5325:Grhl3	UTSW	4	135559104	nonsense	probably null
R6429:Grhl3	UTSW	4	135557196	missense	probably damaging	0.99
R6459:Grhl3	UTSW	4	135557433	missense	possibly damaging	0.46
R7047:Grhl3	UTSW	4	135549240	splice site	probably null
R7073:Grhl3	UTSW	4	135573412	missense	probably benign	0.00
R7345:Grhl3	UTSW	4	135546246	missense	probably damaging	1.00
R7797:Grhl3	UTSW	4	135559105	missense	possibly damaging	0.93
R7829:Grhl3	UTSW	4	135561221	missense	probably damaging	0.98
R8023:Grhl3	UTSW	4	135550329	missense	probably benign
R8472:Grhl3	UTSW	4	135556865	missense	probably benign	0.00
R8499:Grhl3	UTSW	4	135549238	critical splice donor site	probably null
R8766:Grhl3	UTSW	4	135573413	missense	probably benign	0.00
R8836:Grhl3	UTSW	4	135561329	missense	probably damaging	1.00
R9466:Grhl3	UTSW	4	135556101	missense	probably benign	0.06
Z1177:Grhl3	UTSW	4	135552686	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TCACTTGTGAGAAGACCCTTGC -3'
(R):5'- TCCCCAGGGAAATAGGATCATTG -3'

Sequencing Primer
(F):5'- TGTGAGAAGACCCTTGCACCTC -3'
(R):5'- CCAGGGAAATAGGATCATTGTAATTC -3'

Posted On

2015-08-18