Incidental Mutation 'R4521:Grhl3'
List |< first << previous [record 16 of 42] next >> last >|
ID334213
Institutional Source Beutler Lab
Gene Symbol Grhl3
Ensembl Gene ENSMUSG00000037188
Gene Namegrainyhead like transcription factor 3
SynonymsSom, ct, Get1
MMRRC Submission 041764-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock #R4521 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location135541888-135573630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135546250 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 564 (K564E)
Ref Sequence ENSEMBL: ENSMUSP00000101481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105855]
Predicted Effect probably damaging
Transcript: ENSMUST00000105855
AA Change: K564E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101481
Gene: ENSMUSG00000037188
AA Change: K564E

DomainStartEndE-ValueType
Pfam:CP2 215 421 2.5e-81 PFAM
Meta Mutation Damage Score 0.4031 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein may function as a transcription factor during development, and has been shown to stimulate migration of endothelial cells. Multiple transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for the variably penetrant curly-tail mutation (ct) show symptoms of cranial or spinal neural tube defects such as curly tails and/or spina bifida; homozygotes with more severe phenotypes display exencephaly and die in utero. Homozygous knockout mice show severe neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Bora G T 14: 99,068,548 S451I probably damaging Het
Cadm3 A T 1: 173,345,063 probably null Het
Car14 A G 3: 95,904,378 probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdc20b A G 13: 113,081,191 I381M probably damaging Het
Col12a1 C T 9: 79,633,357 V2449I probably benign Het
Crb2 T C 2: 37,795,337 probably benign Het
Dcaf6 A T 1: 165,390,490 D347E probably damaging Het
Dlgap2 G A 8: 14,727,871 R372H probably damaging Het
Fat3 T C 9: 15,922,942 N4118S probably null Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fpr2 A C 17: 17,893,247 R168S probably benign Het
Ghr A G 15: 3,325,958 I281T probably damaging Het
Glmp C A 3: 88,328,039 N259K possibly damaging Het
Helz2 T C 2: 181,228,833 H2875R probably benign Het
Lcp1 A G 14: 75,215,168 D438G possibly damaging Het
Lrfn2 T A 17: 49,069,894 M1K probably null Het
Lrp6 A G 6: 134,485,862 C612R probably damaging Het
Map3k13 T C 16: 21,905,775 V341A possibly damaging Het
Megf8 T A 7: 25,342,701 C1315S probably benign Het
Mrgpra9 A T 7: 47,235,190 L243H probably damaging Het
Mrgprx1 T C 7: 48,021,699 D100G probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nup93 T C 8: 94,314,636 Y801H probably damaging Het
Olfr623 C T 7: 103,660,332 R306H probably benign Het
Olfr810 T A 10: 129,791,181 N136I possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Plpp2 A G 10: 79,530,625 Y118H probably damaging Het
Ppwd1 A G 13: 104,209,659 V496A probably benign Het
Rbm20 A G 19: 53,817,202 N466S probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Skida1 T C 2: 18,045,872 probably benign Het
Stk17b A G 1: 53,764,038 Y73H probably damaging Het
Tapbpl A G 6: 125,228,122 I287T probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Topbp1 T C 9: 103,334,202 probably benign Het
Tsen54 G A 11: 115,817,106 probably null Het
Ttn G A 2: 76,725,216 R28736* probably null Het
Wdr36 G A 18: 32,841,148 probably null Het
Other mutations in Grhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02638:Grhl3 APN 4 135556865 missense probably benign 0.00
IGL02868:Grhl3 APN 4 135554604 missense probably damaging 1.00
Bite-size UTSW 4 135557433 missense possibly damaging 0.46
hammerkop UTSW 4 135546246 missense probably damaging 1.00
hoopoe UTSW 4 135559146 missense probably benign 0.00
R0121:Grhl3 UTSW 4 135552549 missense probably damaging 0.97
R0180:Grhl3 UTSW 4 135554530 missense probably benign 0.00
R0627:Grhl3 UTSW 4 135552681 missense probably benign 0.18
R0727:Grhl3 UTSW 4 135546254 missense possibly damaging 0.90
R1248:Grhl3 UTSW 4 135561306 missense probably benign 0.01
R1664:Grhl3 UTSW 4 135552550 missense probably benign 0.11
R2910:Grhl3 UTSW 4 135559146 missense probably benign 0.00
R2911:Grhl3 UTSW 4 135559146 missense probably benign 0.00
R3773:Grhl3 UTSW 4 135555847 nonsense probably null
R4033:Grhl3 UTSW 4 135573424 start codon destroyed probably benign
R4576:Grhl3 UTSW 4 135561251 missense probably damaging 1.00
R4650:Grhl3 UTSW 4 135549236 splice site probably null
R4697:Grhl3 UTSW 4 135548466 missense probably damaging 1.00
R4919:Grhl3 UTSW 4 135559104 nonsense probably null
R4920:Grhl3 UTSW 4 135559104 nonsense probably null
R4961:Grhl3 UTSW 4 135552607 missense probably damaging 1.00
R5100:Grhl3 UTSW 4 135542675 missense probably benign
R5180:Grhl3 UTSW 4 135559104 nonsense probably null
R5181:Grhl3 UTSW 4 135559104 nonsense probably null
R5325:Grhl3 UTSW 4 135559104 nonsense probably null
R6429:Grhl3 UTSW 4 135557196 missense probably damaging 0.99
R6459:Grhl3 UTSW 4 135557433 missense possibly damaging 0.46
R7047:Grhl3 UTSW 4 135549240 splice site probably null
R7073:Grhl3 UTSW 4 135573412 missense probably benign 0.00
R7345:Grhl3 UTSW 4 135546246 missense probably damaging 1.00
R7797:Grhl3 UTSW 4 135559105 missense possibly damaging 0.93
R7829:Grhl3 UTSW 4 135561221 missense probably damaging 0.98
R8023:Grhl3 UTSW 4 135550329 missense probably benign
Z1177:Grhl3 UTSW 4 135552686 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCACTTGTGAGAAGACCCTTGC -3'
(R):5'- TCCCCAGGGAAATAGGATCATTG -3'

Sequencing Primer
(F):5'- TGTGAGAAGACCCTTGCACCTC -3'
(R):5'- CCAGGGAAATAGGATCATTGTAATTC -3'
Posted On2015-08-18