Mutagenetix > Incidental Mutations

Incidental Mutation 'R4521:Fbxo41'

334215

Institutional Source

Beutler Lab

Gene Symbol

Fbxo41

Ensembl Gene

ENSMUSG00000047013

Gene Name

F-box protein 41

Synonyms

D6Ertd538e

MMRRC Submission

041764-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.274) question?

Stock #

R4521 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85469574-85502994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85484042 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 228 (I228T)

Ref Sequence

ENSEMBL: ENSMUSP00000124754 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159062] [ENSMUST00000161078] [ENSMUST00000161546]

Predicted Effect

probably damaging
Transcript: ENSMUST00000159062
AA Change: I228T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125671
Gene: ENSMUSG00000047013
AA Change: I228T

Domain	Start	End	E-Value	Type
ZnF_C2H2	8	33	5.81e-2	SMART
low complexity region	65	77	N/A	INTRINSIC
low complexity region	100	122	N/A	INTRINSIC
low complexity region	162	192	N/A	INTRINSIC
SCOP:d1eq1a_	197	340	2e-5	SMART
low complexity region	352	374	N/A	INTRINSIC
low complexity region	425	440	N/A	INTRINSIC
Pfam:F-box	536	592	4.8e-5	PFAM
Pfam:F-box-like	554	593	9e-10	PFAM
low complexity region	745	759	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161078
AA Change: I228T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124524
Gene: ENSMUSG00000047013
AA Change: I228T

Domain	Start	End	E-Value	Type
ZnF_C2H2	8	33	5.81e-2	SMART
low complexity region	65	77	N/A	INTRINSIC
low complexity region	100	122	N/A	INTRINSIC
low complexity region	162	192	N/A	INTRINSIC
SCOP:d1eq1a_	197	340	2e-5	SMART
low complexity region	352	374	N/A	INTRINSIC
low complexity region	425	440	N/A	INTRINSIC
Pfam:F-box	536	592	4.8e-5	PFAM
Pfam:F-box-like	554	593	9e-10	PFAM
low complexity region	745	759	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161546
AA Change: I228T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124754
Gene: ENSMUSG00000047013
AA Change: I228T

Domain	Start	End	E-Value	Type
ZnF_C2H2	8	33	5.81e-2	SMART
low complexity region	65	77	N/A	INTRINSIC
low complexity region	100	122	N/A	INTRINSIC
low complexity region	162	192	N/A	INTRINSIC
SCOP:d1eq1a_	197	340	2e-5	SMART
low complexity region	352	374	N/A	INTRINSIC
low complexity region	425	440	N/A	INTRINSIC
low complexity region	519	540	N/A	INTRINSIC
Pfam:F-box-like	554	593	5.6e-10	PFAM
low complexity region	745	759	N/A	INTRINSIC

Meta Mutation Damage Score

0.2564

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which is characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one of the four subunits of the SCF ubiquitin protein ligase complex that plays a role in phosphorylation-dependent ubiquitination. F-box proteins are divided into three classes depending on the interaction substrate domain each contains in addition to the F-box motif: FBXW proteins contain WD-40 domains, FBXL proteins contain leucine-rich repeats, and FBXO proteins contain either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the FBXO class. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality and premature death by 10 weeks, growth retardation, abnormal gait, dragging hindlimbs, ataxia, impaired balance, impaired coordination, tremors and abnormal neuronal migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	A	G	10: 50,660,670	N700D	probably benign	Het
Bora	G	T	14: 99,068,548	S451I	probably damaging	Het
Cadm3	A	T	1: 173,345,063		probably null	Het
Car14	A	G	3: 95,904,378		probably benign	Het
Ccdc88c	G	T	12: 100,913,332	S1843R	possibly damaging	Het
Cdc20b	A	G	13: 113,081,191	I381M	probably damaging	Het
Col12a1	C	T	9: 79,633,357	V2449I	probably benign	Het
Crb2	T	C	2: 37,795,337		probably benign	Het
Dcaf6	A	T	1: 165,390,490	D347E	probably damaging	Het
Dlgap2	G	A	8: 14,727,871	R372H	probably damaging	Het
Fat3	T	C	9: 15,922,942	N4118S	probably null	Het
Fpr2	A	C	17: 17,893,247	R168S	probably benign	Het
Ghr	A	G	15: 3,325,958	I281T	probably damaging	Het
Glmp	C	A	3: 88,328,039	N259K	possibly damaging	Het
Grhl3	T	C	4: 135,546,250	K564E	probably damaging	Het
Helz2	T	C	2: 181,228,833	H2875R	probably benign	Het
Lcp1	A	G	14: 75,215,168	D438G	possibly damaging	Het
Lrfn2	T	A	17: 49,069,894	M1K	probably null	Het
Lrp6	A	G	6: 134,485,862	C612R	probably damaging	Het
Map3k13	T	C	16: 21,905,775	V341A	possibly damaging	Het
Megf8	T	A	7: 25,342,701	C1315S	probably benign	Het
Mrgpra9	A	T	7: 47,235,190	L243H	probably damaging	Het
Mrgprx1	T	C	7: 48,021,699	D100G	probably benign	Het
Nop2	G	T	6: 125,133,552	R47L	probably damaging	Het
Nup93	T	C	8: 94,314,636	Y801H	probably damaging	Het
Olfr623	C	T	7: 103,660,332	R306H	probably benign	Het
Olfr810	T	A	10: 129,791,181	N136I	possibly damaging	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Plce1	T	C	19: 38,524,319	S21P	possibly damaging	Het
Plpp2	A	G	10: 79,530,625	Y118H	probably damaging	Het
Ppwd1	A	G	13: 104,209,659	V496A	probably benign	Het
Rbm20	A	G	19: 53,817,202	N466S	probably benign	Het
Rpl10l	T	C	12: 66,283,738	D207G	probably benign	Het
Skida1	T	C	2: 18,045,872		probably benign	Het
Stk17b	A	G	1: 53,764,038	Y73H	probably damaging	Het
Tapbpl	A	G	6: 125,228,122	I287T	probably damaging	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Topbp1	T	C	9: 103,334,202		probably benign	Het
Tsen54	G	A	11: 115,817,106		probably null	Het
Ttn	G	A	2: 76,725,216	R28736*	probably null	Het
Wdr36	G	A	18: 32,841,148		probably null	Het

Other mutations in Fbxo41

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Fbxo41	APN	6	85478102	splice site	probably null
IGL00919:Fbxo41	APN	6	85478570	missense	probably damaging	1.00
IGL01135:Fbxo41	APN	6	85477908	missense	probably benign	0.41
IGL02084:Fbxo41	APN	6	85480765	critical splice donor site	probably null
IGL02343:Fbxo41	APN	6	85478171	missense	possibly damaging	0.78
IGL03284:Fbxo41	APN	6	85479765	missense	probably damaging	1.00
R0116:Fbxo41	UTSW	6	85477908	missense	probably damaging	1.00
R0452:Fbxo41	UTSW	6	85478182	missense	probably damaging	1.00
R2064:Fbxo41	UTSW	6	85478471	nonsense	probably null
R2065:Fbxo41	UTSW	6	85478471	nonsense	probably null
R2067:Fbxo41	UTSW	6	85478471	nonsense	probably null
R3433:Fbxo41	UTSW	6	85477631	missense	probably damaging	1.00
R3522:Fbxo41	UTSW	6	85484181	missense	probably benign	0.00
R4086:Fbxo41	UTSW	6	85478546	missense	possibly damaging	0.93
R4520:Fbxo41	UTSW	6	85484042	missense	probably damaging	1.00
R4522:Fbxo41	UTSW	6	85484042	missense	probably damaging	1.00
R4523:Fbxo41	UTSW	6	85484042	missense	probably damaging	1.00
R4524:Fbxo41	UTSW	6	85484042	missense	probably damaging	1.00
R4867:Fbxo41	UTSW	6	85475194	missense	probably benign
R4970:Fbxo41	UTSW	6	85477924	missense	probably damaging	1.00
R5000:Fbxo41	UTSW	6	85483919	missense	probably damaging	0.98
R5112:Fbxo41	UTSW	6	85477924	missense	probably damaging	1.00
R5330:Fbxo41	UTSW	6	85479906	missense	probably benign
R5331:Fbxo41	UTSW	6	85479906	missense	probably benign
R5334:Fbxo41	UTSW	6	85478483	missense	probably damaging	1.00
R5595:Fbxo41	UTSW	6	85479901	missense	probably benign	0.00
R5632:Fbxo41	UTSW	6	85484504	missense	probably damaging	1.00
R5698:Fbxo41	UTSW	6	85477656	missense	possibly damaging	0.88
R5801:Fbxo41	UTSW	6	85484533	missense	probably damaging	0.97
R5854:Fbxo41	UTSW	6	85475094	missense	probably damaging	1.00
R6258:Fbxo41	UTSW	6	85478555	missense	probably damaging	1.00
R6260:Fbxo41	UTSW	6	85478555	missense	probably damaging	1.00
R6615:Fbxo41	UTSW	6	85478523	missense	possibly damaging	0.60
R7061:Fbxo41	UTSW	6	85475466	missense	probably benign	0.36
R7353:Fbxo41	UTSW	6	85479976	missense	possibly damaging	0.71
R7681:Fbxo41	UTSW	6	85478479	nonsense	probably null
R8077:Fbxo41	UTSW	6	85473229	missense	probably damaging	0.98
X0024:Fbxo41	UTSW	6	85478470	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGTGAAGCCAGCAGTTC -3'
(R):5'- AATCGAAATCCCACTCGGCG -3'

Sequencing Primer
(F):5'- GAAGCCAGCAGTTCCACGC -3'
(R):5'- AAGTCCGTGGCATCCTCTG -3'

Posted On

2015-08-18