Incidental Mutation 'R4521:Tapbpl'
List |< first << previous [record 37 of 42] next >> last >|
ID334217
Institutional Source Beutler Lab
Gene Symbol Tapbpl
Ensembl Gene ENSMUSG00000038213
Gene NameTAP binding protein-like
SynonymsTAPBPL-R
MMRRC Submission 041764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4521 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location125223933-125231860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125228122 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 287 (I287T)
Ref Sequence ENSEMBL: ENSMUSP00000047105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032486] [ENSMUST00000043422] [ENSMUST00000063588]
Predicted Effect probably benign
Transcript: ENSMUST00000032486
SMART Domains Protein: ENSMUSP00000032486
Gene: ENSMUSG00000030336

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TNFR 27 62 1.11e-2 SMART
TNFR 65 104 1.23e-4 SMART
low complexity region 131 147 N/A INTRINSIC
transmembrane domain 183 202 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000043422
AA Change: I287T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047105
Gene: ENSMUSG00000038213
AA Change: I287T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 202 306 1.11e-5 SMART
IGc1 321 397 3.97e-7 SMART
transmembrane domain 412 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063588
SMART Domains Protein: ENSMUSP00000063466
Gene: ENSMUSG00000030337

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:Synaptobrevin 30 118 5.4e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160523
Meta Mutation Damage Score 0.5844 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tapasin, or TAPBP (MIM 601962), is a member of the variable-constant Ig superfamily that links major histocompatibility complex (MHC) class I molecules to the transporter associated with antigen processing (TAP; see MIM 170260) in the endoplasmic reticulum (ER). The TAPBP gene is located near the MHC complex on chromosome 6p21.3. TAPBPL is a member of the Ig superfamily that is localized on chromosome 12p13.3, a region somewhat paralogous to the MHC.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Bora G T 14: 99,068,548 S451I probably damaging Het
Cadm3 A T 1: 173,345,063 probably null Het
Car14 A G 3: 95,904,378 probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdc20b A G 13: 113,081,191 I381M probably damaging Het
Col12a1 C T 9: 79,633,357 V2449I probably benign Het
Crb2 T C 2: 37,795,337 probably benign Het
Dcaf6 A T 1: 165,390,490 D347E probably damaging Het
Dlgap2 G A 8: 14,727,871 R372H probably damaging Het
Fat3 T C 9: 15,922,942 N4118S probably null Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fpr2 A C 17: 17,893,247 R168S probably benign Het
Ghr A G 15: 3,325,958 I281T probably damaging Het
Glmp C A 3: 88,328,039 N259K possibly damaging Het
Grhl3 T C 4: 135,546,250 K564E probably damaging Het
Helz2 T C 2: 181,228,833 H2875R probably benign Het
Lcp1 A G 14: 75,215,168 D438G possibly damaging Het
Lrfn2 T A 17: 49,069,894 M1K probably null Het
Lrp6 A G 6: 134,485,862 C612R probably damaging Het
Map3k13 T C 16: 21,905,775 V341A possibly damaging Het
Megf8 T A 7: 25,342,701 C1315S probably benign Het
Mrgpra9 A T 7: 47,235,190 L243H probably damaging Het
Mrgprx1 T C 7: 48,021,699 D100G probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nup93 T C 8: 94,314,636 Y801H probably damaging Het
Olfr623 C T 7: 103,660,332 R306H probably benign Het
Olfr810 T A 10: 129,791,181 N136I possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Plpp2 A G 10: 79,530,625 Y118H probably damaging Het
Ppwd1 A G 13: 104,209,659 V496A probably benign Het
Rbm20 A G 19: 53,817,202 N466S probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Skida1 T C 2: 18,045,872 probably benign Het
Stk17b A G 1: 53,764,038 Y73H probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Topbp1 T C 9: 103,334,202 probably benign Het
Tsen54 G A 11: 115,817,106 probably null Het
Ttn G A 2: 76,725,216 R28736* probably null Het
Wdr36 G A 18: 32,841,148 probably null Het
Other mutations in Tapbpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03083:Tapbpl APN 6 125228228 splice site probably null
IGL03308:Tapbpl APN 6 125228179 missense possibly damaging 0.93
BB010:Tapbpl UTSW 6 125230270 missense probably damaging 1.00
BB020:Tapbpl UTSW 6 125230270 missense probably damaging 1.00
R1666:Tapbpl UTSW 6 125230201 missense probably benign 0.00
R3707:Tapbpl UTSW 6 125224695 splice site probably null
R4744:Tapbpl UTSW 6 125228285 missense probably damaging 1.00
R6290:Tapbpl UTSW 6 125230716 missense probably benign 0.00
R6328:Tapbpl UTSW 6 125224918 missense probably benign 0.40
R6565:Tapbpl UTSW 6 125228344 missense probably benign 0.00
R7085:Tapbpl UTSW 6 125226488 splice site probably null
R7251:Tapbpl UTSW 6 125226595 missense probably damaging 0.98
R7933:Tapbpl UTSW 6 125230270 missense probably damaging 1.00
R8230:Tapbpl UTSW 6 125226721 missense probably damaging 1.00
X0026:Tapbpl UTSW 6 125230570 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCAGAATGAAGATGGTGTTTGG -3'
(R):5'- AGTTTCTCCATGGCACCAGG -3'

Sequencing Primer
(F):5'- TGGGTTGTGGGAATGCATTC -3'
(R):5'- ACCTCACTGGCGTGGAGTG -3'
Posted On2015-08-18