Incidental Mutation 'R4521:Lrp6'
ID 334218
Institutional Source Beutler Lab
Gene Symbol Lrp6
Ensembl Gene ENSMUSG00000030201
Gene Name low density lipoprotein receptor-related protein 6
Synonyms ska, Cd, skax26, ska26
MMRRC Submission 041764-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R4521 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 134423439-134543876 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 134462825 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 612 (C612R)
Ref Sequence ENSEMBL: ENSMUSP00000032322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032322]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000032322
AA Change: C612R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032322
Gene: ENSMUSG00000030201
AA Change: C612R

DomainStartEndE-ValueType
LY 43 85 1.55e-2 SMART
LY 87 129 1.91e-11 SMART
LY 130 173 5.19e-13 SMART
LY 174 216 1.39e-13 SMART
LY 217 258 2.87e-6 SMART
EGF 285 324 2.16e-1 SMART
low complexity region 330 341 N/A INTRINSIC
LY 352 394 1.29e-8 SMART
LY 395 437 5.73e-15 SMART
LY 438 481 1.07e-14 SMART
LY 482 524 3.07e-15 SMART
LY 525 565 4.66e-6 SMART
EGF 591 628 1.47e-3 SMART
LY 654 696 2.06e-7 SMART
LY 697 739 3.73e-14 SMART
LY 740 783 3.37e-12 SMART
LY 784 825 1.17e-6 SMART
LY 827 865 1.91e-2 SMART
EGF 892 930 7.35e-4 SMART
LY 957 999 1.41e-5 SMART
LY 1005 1048 5.32e-1 SMART
LY 1049 1093 5e-6 SMART
LY 1094 1136 4.25e-9 SMART
LY 1137 1177 1.91e-2 SMART
EGF 1206 1250 1.23e1 SMART
LDLa 1248 1287 2.42e-12 SMART
LDLa 1288 1324 4.37e-10 SMART
LDLa 1325 1362 1.66e-10 SMART
transmembrane domain 1371 1393 N/A INTRINSIC
low complexity region 1429 1438 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1566 1573 N/A INTRINSIC
low complexity region 1596 1608 N/A INTRINSIC
Meta Mutation Damage Score 0.9750 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]
PHENOTYPE: Animals homozygous for this mutation exhibit partial embryonic lethality, growth retardation, crooked tail, abnormal vertebrae, small skull with occasional bent nose, absence of the third molars and small and/or unerupted lower incisors. Heterozygotes exhibit a crooked tail and abnormal vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,536,766 (GRCm39) N700D probably benign Het
Bora G T 14: 99,305,984 (GRCm39) S451I probably damaging Het
Cadm3 A T 1: 173,172,630 (GRCm39) probably null Het
Car14 A G 3: 95,811,690 (GRCm39) probably benign Het
Ccdc88c G T 12: 100,879,591 (GRCm39) S1843R possibly damaging Het
Cdc20b A G 13: 113,217,725 (GRCm39) I381M probably damaging Het
Col12a1 C T 9: 79,540,639 (GRCm39) V2449I probably benign Het
Crb2 T C 2: 37,685,349 (GRCm39) probably benign Het
Dcaf6 A T 1: 165,218,059 (GRCm39) D347E probably damaging Het
Dlgap2 G A 8: 14,777,871 (GRCm39) R372H probably damaging Het
Fat3 T C 9: 15,834,238 (GRCm39) N4118S probably null Het
Fbxo41 A G 6: 85,461,024 (GRCm39) I228T probably damaging Het
Fpr2 A C 17: 18,113,509 (GRCm39) R168S probably benign Het
Ghr A G 15: 3,355,440 (GRCm39) I281T probably damaging Het
Glmp C A 3: 88,235,346 (GRCm39) N259K possibly damaging Het
Grhl3 T C 4: 135,273,561 (GRCm39) K564E probably damaging Het
Helz2 T C 2: 180,870,626 (GRCm39) H2875R probably benign Het
Lcp1 A G 14: 75,452,608 (GRCm39) D438G possibly damaging Het
Lrfn2 T A 17: 49,376,922 (GRCm39) M1K probably null Het
Map3k13 T C 16: 21,724,525 (GRCm39) V341A possibly damaging Het
Megf8 T A 7: 25,042,126 (GRCm39) C1315S probably benign Het
Mrgpra9 A T 7: 46,884,938 (GRCm39) L243H probably damaging Het
Mrgprx1 T C 7: 47,671,447 (GRCm39) D100G probably benign Het
Nop2 G T 6: 125,110,515 (GRCm39) R47L probably damaging Het
Nup93 T C 8: 95,041,264 (GRCm39) Y801H probably damaging Het
Or51b6b C T 7: 103,309,539 (GRCm39) R306H probably benign Het
Or6c69b T A 10: 129,627,050 (GRCm39) N136I possibly damaging Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Plce1 T C 19: 38,512,763 (GRCm39) S21P possibly damaging Het
Plpp2 A G 10: 79,366,459 (GRCm39) Y118H probably damaging Het
Ppwd1 A G 13: 104,346,167 (GRCm39) V496A probably benign Het
Rbm20 A G 19: 53,805,633 (GRCm39) N466S probably benign Het
Rpl10l T C 12: 66,330,512 (GRCm39) D207G probably benign Het
Skida1 T C 2: 18,050,683 (GRCm39) probably benign Het
Stk17b A G 1: 53,803,197 (GRCm39) Y73H probably damaging Het
Tapbpl A G 6: 125,205,085 (GRCm39) I287T probably damaging Het
Tmem38a C T 8: 73,326,005 (GRCm39) P20S possibly damaging Het
Topbp1 T C 9: 103,211,401 (GRCm39) probably benign Het
Tsen54 G A 11: 115,707,932 (GRCm39) probably null Het
Ttn G A 2: 76,555,560 (GRCm39) R28736* probably null Het
Wdr36 G A 18: 32,974,201 (GRCm39) probably null Het
Other mutations in Lrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lrp6 APN 6 134,433,053 (GRCm39) missense probably benign 0.17
IGL00765:Lrp6 APN 6 134,518,817 (GRCm39) missense probably benign 0.02
IGL00898:Lrp6 APN 6 134,456,702 (GRCm39) missense probably damaging 0.99
IGL00916:Lrp6 APN 6 134,461,252 (GRCm39) missense probably damaging 1.00
IGL00961:Lrp6 APN 6 134,484,609 (GRCm39) missense probably damaging 0.98
IGL01620:Lrp6 APN 6 134,488,225 (GRCm39) missense probably damaging 1.00
IGL01765:Lrp6 APN 6 134,433,108 (GRCm39) missense probably damaging 0.99
IGL02066:Lrp6 APN 6 134,427,900 (GRCm39) nonsense probably null
IGL02067:Lrp6 APN 6 134,457,359 (GRCm39) missense probably damaging 0.99
IGL02169:Lrp6 APN 6 134,490,290 (GRCm39) missense probably damaging 0.96
IGL02281:Lrp6 APN 6 134,434,697 (GRCm39) missense probably benign 0.40
IGL02484:Lrp6 APN 6 134,518,886 (GRCm39) missense probably benign 0.15
IGL02724:Lrp6 APN 6 134,461,228 (GRCm39) missense probably damaging 1.00
IGL02876:Lrp6 APN 6 134,433,077 (GRCm39) missense probably benign 0.43
IGL03011:Lrp6 APN 6 134,497,380 (GRCm39) missense possibly damaging 0.80
IGL03352:Lrp6 APN 6 134,456,726 (GRCm39) missense probably damaging 1.00
Aileron UTSW 6 134,439,579 (GRCm39) missense probably damaging 1.00
Cielo UTSW 6 134,484,624 (GRCm39) nonsense probably null
Coiled UTSW 6 134,484,521 (GRCm39) nonsense probably null
flap UTSW 6 134,463,549 (GRCm39) missense probably damaging 0.99
soar UTSW 6 134,488,169 (GRCm39) missense probably damaging 0.97
Swoop UTSW 6 134,463,504 (GRCm39) missense possibly damaging 0.94
Upswing UTSW 6 134,441,414 (GRCm39) missense probably damaging 0.99
Wingman UTSW 6 134,434,705 (GRCm39) missense probably damaging 1.00
BB004:Lrp6 UTSW 6 134,497,513 (GRCm39) missense probably damaging 1.00
BB014:Lrp6 UTSW 6 134,497,513 (GRCm39) missense probably damaging 1.00
PIT4494001:Lrp6 UTSW 6 134,456,741 (GRCm39) missense probably damaging 1.00
R0008:Lrp6 UTSW 6 134,462,716 (GRCm39) missense probably damaging 0.96
R0008:Lrp6 UTSW 6 134,462,716 (GRCm39) missense probably damaging 0.96
R0201:Lrp6 UTSW 6 134,427,860 (GRCm39) nonsense probably null
R0295:Lrp6 UTSW 6 134,434,656 (GRCm39) missense probably benign 0.02
R0370:Lrp6 UTSW 6 134,456,729 (GRCm39) missense probably damaging 1.00
R0382:Lrp6 UTSW 6 134,444,631 (GRCm39) missense probably damaging 1.00
R0413:Lrp6 UTSW 6 134,484,587 (GRCm39) missense probably damaging 0.99
R0468:Lrp6 UTSW 6 134,462,624 (GRCm39) missense possibly damaging 0.94
R0492:Lrp6 UTSW 6 134,457,481 (GRCm39) missense possibly damaging 0.58
R0584:Lrp6 UTSW 6 134,433,039 (GRCm39) missense probably damaging 0.99
R0631:Lrp6 UTSW 6 134,456,738 (GRCm39) missense possibly damaging 0.95
R0738:Lrp6 UTSW 6 134,519,008 (GRCm39) missense probably benign 0.13
R0907:Lrp6 UTSW 6 134,484,488 (GRCm39) missense probably damaging 0.96
R1273:Lrp6 UTSW 6 134,444,470 (GRCm39) critical splice donor site probably null
R1548:Lrp6 UTSW 6 134,436,392 (GRCm39) missense possibly damaging 0.89
R1639:Lrp6 UTSW 6 134,430,529 (GRCm39) missense possibly damaging 0.68
R1650:Lrp6 UTSW 6 134,445,732 (GRCm39) missense probably benign 0.01
R1696:Lrp6 UTSW 6 134,445,686 (GRCm39) missense probably damaging 1.00
R1751:Lrp6 UTSW 6 134,441,531 (GRCm39) missense probably damaging 1.00
R1780:Lrp6 UTSW 6 134,441,414 (GRCm39) missense probably damaging 0.99
R2013:Lrp6 UTSW 6 134,457,337 (GRCm39) critical splice donor site probably null
R2015:Lrp6 UTSW 6 134,457,337 (GRCm39) critical splice donor site probably null
R2165:Lrp6 UTSW 6 134,436,246 (GRCm39) missense probably damaging 1.00
R2294:Lrp6 UTSW 6 134,434,705 (GRCm39) missense probably damaging 1.00
R2336:Lrp6 UTSW 6 134,484,546 (GRCm39) missense probably damaging 0.97
R2964:Lrp6 UTSW 6 134,444,489 (GRCm39) missense probably damaging 1.00
R3716:Lrp6 UTSW 6 134,484,410 (GRCm39) missense probably damaging 1.00
R4017:Lrp6 UTSW 6 134,497,513 (GRCm39) missense probably damaging 1.00
R4370:Lrp6 UTSW 6 134,483,321 (GRCm39) nonsense probably null
R4573:Lrp6 UTSW 6 134,447,693 (GRCm39) nonsense probably null
R4645:Lrp6 UTSW 6 134,461,213 (GRCm39) missense probably damaging 1.00
R4661:Lrp6 UTSW 6 134,488,230 (GRCm39) missense probably benign
R4688:Lrp6 UTSW 6 134,456,706 (GRCm39) missense probably damaging 1.00
R4784:Lrp6 UTSW 6 134,456,502 (GRCm39) missense probably benign 0.06
R5236:Lrp6 UTSW 6 134,488,227 (GRCm39) missense probably damaging 1.00
R5506:Lrp6 UTSW 6 134,436,259 (GRCm39) missense probably benign 0.09
R5508:Lrp6 UTSW 6 134,441,479 (GRCm39) missense probably benign 0.31
R6001:Lrp6 UTSW 6 134,441,481 (GRCm39) missense probably benign 0.03
R6319:Lrp6 UTSW 6 134,518,798 (GRCm39) missense possibly damaging 0.46
R6537:Lrp6 UTSW 6 134,457,458 (GRCm39) missense probably benign
R6552:Lrp6 UTSW 6 134,431,692 (GRCm39) missense probably benign 0.17
R6559:Lrp6 UTSW 6 134,490,217 (GRCm39) missense probably damaging 1.00
R6575:Lrp6 UTSW 6 134,518,934 (GRCm39) missense possibly damaging 0.80
R6585:Lrp6 UTSW 6 134,484,521 (GRCm39) nonsense probably null
R6700:Lrp6 UTSW 6 134,456,523 (GRCm39) missense probably damaging 1.00
R6724:Lrp6 UTSW 6 134,463,504 (GRCm39) missense possibly damaging 0.94
R7159:Lrp6 UTSW 6 134,484,514 (GRCm39) missense probably benign
R7266:Lrp6 UTSW 6 134,484,364 (GRCm39) missense probably damaging 1.00
R7339:Lrp6 UTSW 6 134,427,781 (GRCm39) missense probably damaging 1.00
R7341:Lrp6 UTSW 6 134,427,781 (GRCm39) missense probably damaging 1.00
R7342:Lrp6 UTSW 6 134,427,781 (GRCm39) missense probably damaging 1.00
R7348:Lrp6 UTSW 6 134,427,781 (GRCm39) missense probably damaging 1.00
R7359:Lrp6 UTSW 6 134,427,923 (GRCm39) nonsense probably null
R7366:Lrp6 UTSW 6 134,427,781 (GRCm39) missense probably damaging 1.00
R7368:Lrp6 UTSW 6 134,427,781 (GRCm39) missense probably damaging 1.00
R7501:Lrp6 UTSW 6 134,463,471 (GRCm39) missense probably damaging 1.00
R7548:Lrp6 UTSW 6 134,484,471 (GRCm39) missense probably damaging 0.97
R7652:Lrp6 UTSW 6 134,488,208 (GRCm39) nonsense probably null
R7771:Lrp6 UTSW 6 134,439,579 (GRCm39) missense probably damaging 1.00
R7927:Lrp6 UTSW 6 134,497,513 (GRCm39) missense probably damaging 1.00
R8717:Lrp6 UTSW 6 134,434,711 (GRCm39) missense probably benign 0.41
R8726:Lrp6 UTSW 6 134,484,624 (GRCm39) nonsense probably null
R8792:Lrp6 UTSW 6 134,463,549 (GRCm39) missense probably damaging 0.99
R8812:Lrp6 UTSW 6 134,433,141 (GRCm39) missense probably benign
R8855:Lrp6 UTSW 6 134,445,785 (GRCm39) missense probably benign 0.04
R8866:Lrp6 UTSW 6 134,445,785 (GRCm39) missense probably benign 0.04
R8994:Lrp6 UTSW 6 134,518,656 (GRCm39) missense probably benign
R9021:Lrp6 UTSW 6 134,518,930 (GRCm39) missense probably benign 0.00
R9089:Lrp6 UTSW 6 134,488,169 (GRCm39) missense probably damaging 0.97
R9154:Lrp6 UTSW 6 134,518,855 (GRCm39) missense probably damaging 1.00
R9263:Lrp6 UTSW 6 134,457,467 (GRCm39) missense probably damaging 1.00
R9287:Lrp6 UTSW 6 134,483,259 (GRCm39) missense probably benign 0.21
R9545:Lrp6 UTSW 6 134,483,329 (GRCm39) missense probably damaging 1.00
R9574:Lrp6 UTSW 6 134,447,662 (GRCm39) missense possibly damaging 0.90
R9640:Lrp6 UTSW 6 134,441,414 (GRCm39) missense probably damaging 0.99
Z1176:Lrp6 UTSW 6 134,433,120 (GRCm39) missense possibly damaging 0.72
Z1177:Lrp6 UTSW 6 134,439,504 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGTAAATCCTGTTGTCTGTGAC -3'
(R):5'- GAGTTGGAACTAGGTCAGGACC -3'

Sequencing Primer
(F):5'- CTGTTGTCTGTGACATCAAAATCC -3'
(R):5'- TCAGGACCGACAGAAGAACCATG -3'
Posted On 2015-08-18