Incidental Mutation 'R4521:Lrp6'
List |< first << previous [record 20 of 42] next >> last >|
ID334218
Institutional Source Beutler Lab
Gene Symbol Lrp6
Ensembl Gene ENSMUSG00000030201
Gene Namelow density lipoprotein receptor-related protein 6
Synonymsskax26, Cd, ska26, ska
MMRRC Submission 041764-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4521 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location134446476-134566965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134485862 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 612 (C612R)
Ref Sequence ENSEMBL: ENSMUSP00000032322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032322]
Predicted Effect probably damaging
Transcript: ENSMUST00000032322
AA Change: C612R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032322
Gene: ENSMUSG00000030201
AA Change: C612R

DomainStartEndE-ValueType
LY 43 85 1.55e-2 SMART
LY 87 129 1.91e-11 SMART
LY 130 173 5.19e-13 SMART
LY 174 216 1.39e-13 SMART
LY 217 258 2.87e-6 SMART
EGF 285 324 2.16e-1 SMART
low complexity region 330 341 N/A INTRINSIC
LY 352 394 1.29e-8 SMART
LY 395 437 5.73e-15 SMART
LY 438 481 1.07e-14 SMART
LY 482 524 3.07e-15 SMART
LY 525 565 4.66e-6 SMART
EGF 591 628 1.47e-3 SMART
LY 654 696 2.06e-7 SMART
LY 697 739 3.73e-14 SMART
LY 740 783 3.37e-12 SMART
LY 784 825 1.17e-6 SMART
LY 827 865 1.91e-2 SMART
EGF 892 930 7.35e-4 SMART
LY 957 999 1.41e-5 SMART
LY 1005 1048 5.32e-1 SMART
LY 1049 1093 5e-6 SMART
LY 1094 1136 4.25e-9 SMART
LY 1137 1177 1.91e-2 SMART
EGF 1206 1250 1.23e1 SMART
LDLa 1248 1287 2.42e-12 SMART
LDLa 1288 1324 4.37e-10 SMART
LDLa 1325 1362 1.66e-10 SMART
transmembrane domain 1371 1393 N/A INTRINSIC
low complexity region 1429 1438 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1566 1573 N/A INTRINSIC
low complexity region 1596 1608 N/A INTRINSIC
Meta Mutation Damage Score 0.9750 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]
PHENOTYPE: Animals homozygous for this mutation exhibit partial embryonic lethality, growth retardation, crooked tail, abnormal vertebrae, small skull with occasional bent nose, absence of the third molars and small and/or unerupted lower incisors. Heterozygotes exhibit a crooked tail and abnormal vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Bora G T 14: 99,068,548 S451I probably damaging Het
Cadm3 A T 1: 173,345,063 probably null Het
Car14 A G 3: 95,904,378 probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdc20b A G 13: 113,081,191 I381M probably damaging Het
Col12a1 C T 9: 79,633,357 V2449I probably benign Het
Crb2 T C 2: 37,795,337 probably benign Het
Dcaf6 A T 1: 165,390,490 D347E probably damaging Het
Dlgap2 G A 8: 14,727,871 R372H probably damaging Het
Fat3 T C 9: 15,922,942 N4118S probably null Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fpr2 A C 17: 17,893,247 R168S probably benign Het
Ghr A G 15: 3,325,958 I281T probably damaging Het
Glmp C A 3: 88,328,039 N259K possibly damaging Het
Grhl3 T C 4: 135,546,250 K564E probably damaging Het
Helz2 T C 2: 181,228,833 H2875R probably benign Het
Lcp1 A G 14: 75,215,168 D438G possibly damaging Het
Lrfn2 T A 17: 49,069,894 M1K probably null Het
Map3k13 T C 16: 21,905,775 V341A possibly damaging Het
Megf8 T A 7: 25,342,701 C1315S probably benign Het
Mrgpra9 A T 7: 47,235,190 L243H probably damaging Het
Mrgprx1 T C 7: 48,021,699 D100G probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nup93 T C 8: 94,314,636 Y801H probably damaging Het
Olfr623 C T 7: 103,660,332 R306H probably benign Het
Olfr810 T A 10: 129,791,181 N136I possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Plpp2 A G 10: 79,530,625 Y118H probably damaging Het
Ppwd1 A G 13: 104,209,659 V496A probably benign Het
Rbm20 A G 19: 53,817,202 N466S probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Skida1 T C 2: 18,045,872 probably benign Het
Stk17b A G 1: 53,764,038 Y73H probably damaging Het
Tapbpl A G 6: 125,228,122 I287T probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Topbp1 T C 9: 103,334,202 probably benign Het
Tsen54 G A 11: 115,817,106 probably null Het
Ttn G A 2: 76,725,216 R28736* probably null Het
Wdr36 G A 18: 32,841,148 probably null Het
Other mutations in Lrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lrp6 APN 6 134456090 missense probably benign 0.17
IGL00765:Lrp6 APN 6 134541854 missense probably benign 0.02
IGL00898:Lrp6 APN 6 134479739 missense probably damaging 0.99
IGL00916:Lrp6 APN 6 134484289 missense probably damaging 1.00
IGL00961:Lrp6 APN 6 134507646 missense probably damaging 0.98
IGL01620:Lrp6 APN 6 134511262 missense probably damaging 1.00
IGL01765:Lrp6 APN 6 134456145 missense probably damaging 0.99
IGL02066:Lrp6 APN 6 134450937 nonsense probably null
IGL02067:Lrp6 APN 6 134480396 missense probably damaging 0.99
IGL02169:Lrp6 APN 6 134513327 missense probably damaging 0.96
IGL02281:Lrp6 APN 6 134457734 missense probably benign 0.40
IGL02484:Lrp6 APN 6 134541923 missense probably benign 0.15
IGL02724:Lrp6 APN 6 134484265 missense probably damaging 1.00
IGL02876:Lrp6 APN 6 134456114 missense probably benign 0.43
IGL03011:Lrp6 APN 6 134520417 missense possibly damaging 0.80
IGL03352:Lrp6 APN 6 134479763 missense probably damaging 1.00
Coiled UTSW 6 134507558 nonsense probably null
BB004:Lrp6 UTSW 6 134520550 missense probably damaging 1.00
BB014:Lrp6 UTSW 6 134520550 missense probably damaging 1.00
PIT4494001:Lrp6 UTSW 6 134479778 missense probably damaging 1.00
R0008:Lrp6 UTSW 6 134485753 missense probably damaging 0.96
R0008:Lrp6 UTSW 6 134485753 missense probably damaging 0.96
R0201:Lrp6 UTSW 6 134450897 nonsense probably null
R0295:Lrp6 UTSW 6 134457693 missense probably benign 0.02
R0370:Lrp6 UTSW 6 134479766 missense probably damaging 1.00
R0382:Lrp6 UTSW 6 134467668 missense probably damaging 1.00
R0413:Lrp6 UTSW 6 134507624 missense probably damaging 0.99
R0468:Lrp6 UTSW 6 134485661 missense possibly damaging 0.94
R0492:Lrp6 UTSW 6 134480518 missense possibly damaging 0.58
R0584:Lrp6 UTSW 6 134456076 missense probably damaging 0.99
R0631:Lrp6 UTSW 6 134479775 missense possibly damaging 0.95
R0738:Lrp6 UTSW 6 134542045 missense probably benign 0.13
R0907:Lrp6 UTSW 6 134507525 missense probably damaging 0.96
R1273:Lrp6 UTSW 6 134467507 critical splice donor site probably null
R1548:Lrp6 UTSW 6 134459429 missense possibly damaging 0.89
R1639:Lrp6 UTSW 6 134453566 missense possibly damaging 0.68
R1650:Lrp6 UTSW 6 134468769 missense probably benign 0.01
R1696:Lrp6 UTSW 6 134468723 missense probably damaging 1.00
R1751:Lrp6 UTSW 6 134464568 missense probably damaging 1.00
R1780:Lrp6 UTSW 6 134464451 missense probably damaging 0.99
R2013:Lrp6 UTSW 6 134480374 critical splice donor site probably null
R2015:Lrp6 UTSW 6 134480374 critical splice donor site probably null
R2165:Lrp6 UTSW 6 134459283 missense probably damaging 1.00
R2294:Lrp6 UTSW 6 134457742 missense probably damaging 1.00
R2336:Lrp6 UTSW 6 134507583 missense probably damaging 0.97
R2964:Lrp6 UTSW 6 134467526 missense probably damaging 1.00
R3716:Lrp6 UTSW 6 134507447 missense probably damaging 1.00
R4017:Lrp6 UTSW 6 134520550 missense probably damaging 1.00
R4370:Lrp6 UTSW 6 134506358 nonsense probably null
R4573:Lrp6 UTSW 6 134470730 nonsense probably null
R4645:Lrp6 UTSW 6 134484250 missense probably damaging 1.00
R4661:Lrp6 UTSW 6 134511267 missense probably benign
R4688:Lrp6 UTSW 6 134479743 missense probably damaging 1.00
R4784:Lrp6 UTSW 6 134479539 missense probably benign 0.06
R5236:Lrp6 UTSW 6 134511264 missense probably damaging 1.00
R5506:Lrp6 UTSW 6 134459296 missense probably benign 0.09
R5508:Lrp6 UTSW 6 134464516 missense probably benign 0.31
R6001:Lrp6 UTSW 6 134464518 missense probably benign 0.03
R6319:Lrp6 UTSW 6 134541835 missense possibly damaging 0.46
R6537:Lrp6 UTSW 6 134480495 missense probably benign
R6552:Lrp6 UTSW 6 134454729 missense probably benign 0.17
R6559:Lrp6 UTSW 6 134513254 missense probably damaging 1.00
R6575:Lrp6 UTSW 6 134541971 missense possibly damaging 0.80
R6585:Lrp6 UTSW 6 134507558 nonsense probably null
R6700:Lrp6 UTSW 6 134479560 missense probably damaging 1.00
R6724:Lrp6 UTSW 6 134486541 missense possibly damaging 0.94
R7159:Lrp6 UTSW 6 134507551 missense probably benign
R7266:Lrp6 UTSW 6 134507401 missense probably damaging 1.00
R7339:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7341:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7342:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7348:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7359:Lrp6 UTSW 6 134450960 nonsense probably null
R7366:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7368:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7501:Lrp6 UTSW 6 134486508 missense probably damaging 1.00
R7548:Lrp6 UTSW 6 134507508 missense probably damaging 0.97
R7652:Lrp6 UTSW 6 134511245 nonsense probably null
R7771:Lrp6 UTSW 6 134462616 missense probably damaging 1.00
R7927:Lrp6 UTSW 6 134520550 missense probably damaging 1.00
Z1176:Lrp6 UTSW 6 134456157 missense possibly damaging 0.72
Z1177:Lrp6 UTSW 6 134462541 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGTAAATCCTGTTGTCTGTGAC -3'
(R):5'- GAGTTGGAACTAGGTCAGGACC -3'

Sequencing Primer
(F):5'- CTGTTGTCTGTGACATCAAAATCC -3'
(R):5'- TCAGGACCGACAGAAGAACCATG -3'
Posted On2015-08-18