Incidental Mutation 'R4521:Megf8'
ID334219
Institutional Source Beutler Lab
Gene Symbol Megf8
Ensembl Gene ENSMUSG00000045039
Gene Namemultiple EGF-like-domains 8
SynonymsEgfl4, b2b1702Clo, m687Ddg, b2b288Clo
MMRRC Submission 041764-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R4521 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25317164-25365917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25342701 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1315 (C1315S)
Ref Sequence ENSEMBL: ENSMUSP00000122192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128119]
Predicted Effect probably benign
Transcript: ENSMUST00000128119
AA Change: C1315S

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122192
Gene: ENSMUSG00000045039
AA Change: C1315S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 33 140 1.24e-15 SMART
EGF 141 170 4.26e0 SMART
EGF 173 203 2.43e1 SMART
Pfam:Kelch_4 227 277 1.3e-11 PFAM
Pfam:Kelch_3 240 287 1.6e-7 PFAM
low complexity region 320 341 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 728 738 N/A INTRINSIC
PSI 847 899 1.37e0 SMART
low complexity region 932 938 N/A INTRINSIC
PSI 949 991 2.11e-2 SMART
PSI 1005 1073 7.82e-1 SMART
EGF_CA 1074 1115 2.62e-9 SMART
EGF 1117 1160 5.4e-2 SMART
EGF_like 1163 1208 4e-1 SMART
EGF_Lam 1211 1259 1.03e-7 SMART
Blast:CUB 1263 1401 1e-30 BLAST
EGF_like 1406 1445 3.29e1 SMART
Pfam:Kelch_4 1509 1564 6.5e-12 PFAM
Pfam:Kelch_3 1520 1574 1.2e-10 PFAM
PSI 1868 1923 2.75e-1 SMART
PSI 2004 2062 1.6e0 SMART
PSI 2064 2121 1.68e-5 SMART
EGF 2125 2164 1.08e-1 SMART
EGF 2166 2194 4.26e0 SMART
EGF 2204 2244 2.2e1 SMART
EGF_like 2248 2321 6.37e-1 SMART
low complexity region 2493 2504 N/A INTRINSIC
low complexity region 2530 2541 N/A INTRINSIC
transmembrane domain 2592 2614 N/A INTRINSIC
low complexity region 2649 2668 N/A INTRINSIC
low complexity region 2674 2702 N/A INTRINSIC
low complexity region 2759 2774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153077
Meta Mutation Damage Score 0.3351 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein of unknown function that contains several EGF-like domains, Kelch repeats, and PSI domains. Defects in this gene are a cause of Carpenter syndrome 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit varying degrees of heterotaxia and congenital heart defects. Mice homozygous for another ENU-induced mutation exhibit abnormal development and patterning of the peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Bora G T 14: 99,068,548 S451I probably damaging Het
Cadm3 A T 1: 173,345,063 probably null Het
Car14 A G 3: 95,904,378 probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdc20b A G 13: 113,081,191 I381M probably damaging Het
Col12a1 C T 9: 79,633,357 V2449I probably benign Het
Crb2 T C 2: 37,795,337 probably benign Het
Dcaf6 A T 1: 165,390,490 D347E probably damaging Het
Dlgap2 G A 8: 14,727,871 R372H probably damaging Het
Fat3 T C 9: 15,922,942 N4118S probably null Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fpr2 A C 17: 17,893,247 R168S probably benign Het
Ghr A G 15: 3,325,958 I281T probably damaging Het
Glmp C A 3: 88,328,039 N259K possibly damaging Het
Grhl3 T C 4: 135,546,250 K564E probably damaging Het
Helz2 T C 2: 181,228,833 H2875R probably benign Het
Lcp1 A G 14: 75,215,168 D438G possibly damaging Het
Lrfn2 T A 17: 49,069,894 M1K probably null Het
Lrp6 A G 6: 134,485,862 C612R probably damaging Het
Map3k13 T C 16: 21,905,775 V341A possibly damaging Het
Mrgpra9 A T 7: 47,235,190 L243H probably damaging Het
Mrgprx1 T C 7: 48,021,699 D100G probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nup93 T C 8: 94,314,636 Y801H probably damaging Het
Olfr623 C T 7: 103,660,332 R306H probably benign Het
Olfr810 T A 10: 129,791,181 N136I possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Plpp2 A G 10: 79,530,625 Y118H probably damaging Het
Ppwd1 A G 13: 104,209,659 V496A probably benign Het
Rbm20 A G 19: 53,817,202 N466S probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Skida1 T C 2: 18,045,872 probably benign Het
Stk17b A G 1: 53,764,038 Y73H probably damaging Het
Tapbpl A G 6: 125,228,122 I287T probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Topbp1 T C 9: 103,334,202 probably benign Het
Tsen54 G A 11: 115,817,106 probably null Het
Ttn G A 2: 76,725,216 R28736* probably null Het
Wdr36 G A 18: 32,841,148 probably null Het
Other mutations in Megf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Megf8 APN 7 25343684 missense possibly damaging 0.87
IGL00696:Megf8 APN 7 25342392 missense probably benign
IGL01021:Megf8 APN 7 25338374 missense probably benign 0.39
IGL01290:Megf8 APN 7 25349658 nonsense probably null
IGL01392:Megf8 APN 7 25363749 missense probably benign 0.03
IGL01410:Megf8 APN 7 25359871 missense probably benign 0.01
IGL01634:Megf8 APN 7 25358781 splice site probably benign
IGL01648:Megf8 APN 7 25327572 missense probably damaging 1.00
IGL01930:Megf8 APN 7 25334861 missense probably damaging 1.00
IGL01954:Megf8 APN 7 25349014 missense possibly damaging 0.94
IGL02150:Megf8 APN 7 25346417 splice site probably null
IGL02192:Megf8 APN 7 25353860 missense probably damaging 1.00
IGL02250:Megf8 APN 7 25342575 missense probably benign 0.02
IGL02301:Megf8 APN 7 25337900 missense probably damaging 0.96
IGL02317:Megf8 APN 7 25363788 missense probably damaging 1.00
IGL02324:Megf8 APN 7 25340448 missense probably benign 0.10
IGL02503:Megf8 APN 7 25363563 missense possibly damaging 0.70
IGL02583:Megf8 APN 7 25355793 missense probably benign
IGL02636:Megf8 APN 7 25358432 missense probably damaging 0.99
IGL02704:Megf8 APN 7 25359782 missense probably damaging 0.97
IGL02898:Megf8 APN 7 25346508 missense possibly damaging 0.79
IGL03082:Megf8 APN 7 25330236 missense probably benign
IGL03182:Megf8 APN 7 25347348 missense possibly damaging 0.92
megatherium UTSW 7 25342425 critical splice donor site probably null
PIT4810001:Megf8 UTSW 7 25342285 missense probably damaging 1.00
R0076:Megf8 UTSW 7 25353958 critical splice donor site probably null
R0217:Megf8 UTSW 7 25364079 missense probably damaging 0.99
R0514:Megf8 UTSW 7 25364303 missense possibly damaging 0.86
R0561:Megf8 UTSW 7 25328832 missense probably benign 0.21
R0563:Megf8 UTSW 7 25342395 missense probably damaging 1.00
R0601:Megf8 UTSW 7 25328540 missense probably benign 0.03
R0879:Megf8 UTSW 7 25338471 missense possibly damaging 0.58
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1430:Megf8 UTSW 7 25364343 missense possibly damaging 0.86
R1445:Megf8 UTSW 7 25342656 missense probably damaging 0.97
R1533:Megf8 UTSW 7 25334855 missense possibly damaging 0.70
R1606:Megf8 UTSW 7 25358695 missense probably damaging 1.00
R1635:Megf8 UTSW 7 25346747 missense possibly damaging 0.77
R1654:Megf8 UTSW 7 25338486 missense possibly damaging 0.56
R1661:Megf8 UTSW 7 25363847 missense probably damaging 1.00
R1880:Megf8 UTSW 7 25334860 missense possibly damaging 0.68
R1962:Megf8 UTSW 7 25363551 missense probably damaging 1.00
R2077:Megf8 UTSW 7 25353738 missense probably benign 0.15
R2127:Megf8 UTSW 7 25364582 missense possibly damaging 0.73
R2129:Megf8 UTSW 7 25330715 missense probably damaging 0.98
R2199:Megf8 UTSW 7 25339614 missense possibly damaging 0.87
R2201:Megf8 UTSW 7 25340745 missense probably damaging 1.00
R2205:Megf8 UTSW 7 25341748 missense probably benign 0.13
R2207:Megf8 UTSW 7 25349797 missense probably damaging 0.97
R2361:Megf8 UTSW 7 25348954 missense possibly damaging 0.94
R2680:Megf8 UTSW 7 25317556 missense probably benign 0.01
R3084:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3085:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3086:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3433:Megf8 UTSW 7 25360124 missense probably benign 0.00
R3939:Megf8 UTSW 7 25359202 missense probably benign 0.07
R4022:Megf8 UTSW 7 25337775 missense probably damaging 1.00
R4214:Megf8 UTSW 7 25355368 missense probably benign 0.03
R4357:Megf8 UTSW 7 25355749 missense probably benign 0.02
R4620:Megf8 UTSW 7 25355098 missense possibly damaging 0.92
R4700:Megf8 UTSW 7 25363515 missense probably damaging 1.00
R4916:Megf8 UTSW 7 25339664 missense probably benign 0.24
R4940:Megf8 UTSW 7 25360706 missense probably damaging 1.00
R5048:Megf8 UTSW 7 25331092 missense possibly damaging 0.71
R5258:Megf8 UTSW 7 25348326 missense possibly damaging 0.88
R5271:Megf8 UTSW 7 25341706 missense probably damaging 1.00
R5390:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5391:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5708:Megf8 UTSW 7 25334597 missense probably benign 0.03
R5752:Megf8 UTSW 7 25355114 missense probably damaging 0.97
R5930:Megf8 UTSW 7 25326441 nonsense probably null
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6153:Megf8 UTSW 7 25347371 missense possibly damaging 0.93
R6210:Megf8 UTSW 7 25343720 missense possibly damaging 0.90
R6457:Megf8 UTSW 7 25349695 missense probably damaging 0.99
R6659:Megf8 UTSW 7 25358734 missense probably benign 0.38
R6867:Megf8 UTSW 7 25331035 missense probably benign 0.42
R6896:Megf8 UTSW 7 25329932 missense probably benign 0.00
R6899:Megf8 UTSW 7 25360713 missense probably damaging 1.00
R6905:Megf8 UTSW 7 25337932 missense probably benign 0.02
R7099:Megf8 UTSW 7 25346520 missense probably damaging 0.99
R7172:Megf8 UTSW 7 25343667 missense probably damaging 0.99
R7378:Megf8 UTSW 7 25348942 missense probably damaging 1.00
R7427:Megf8 UTSW 7 25338371 missense probably benign 0.44
R7492:Megf8 UTSW 7 25353848 missense probably benign 0.24
R7699:Megf8 UTSW 7 25329928 missense possibly damaging 0.91
R7700:Megf8 UTSW 7 25329928 missense possibly damaging 0.91
R7756:Megf8 UTSW 7 25342425 critical splice donor site probably null
R7758:Megf8 UTSW 7 25342425 critical splice donor site probably null
R7786:Megf8 UTSW 7 25317695 critical splice donor site probably null
R7797:Megf8 UTSW 7 25334597 missense probably damaging 0.99
R7881:Megf8 UTSW 7 25340635 missense possibly damaging 0.72
R8165:Megf8 UTSW 7 25353873 missense probably damaging 1.00
R8258:Megf8 UTSW 7 25358423 missense probably benign 0.03
R8259:Megf8 UTSW 7 25358423 missense probably benign 0.03
Z1088:Megf8 UTSW 7 25339669 missense possibly damaging 0.87
Z1177:Megf8 UTSW 7 25346162 missense probably damaging 1.00
Z1177:Megf8 UTSW 7 25347369 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATTTCTTTCCGTAGAGCTGG -3'
(R):5'- CTGGATGACCTGACCAATGG -3'

Sequencing Primer
(F):5'- TGGTGGCTCCTGCTTCCG -3'
(R):5'- GATGACCTGACCAATGGTTTTAG -3'
Posted On2015-08-18