Mutagenetix > Incidental Mutation

Incidental Mutation 'R4521:Dlgap2'

334224

Institutional Source

Beutler Lab

Gene Symbol

Dlgap2

Ensembl Gene

ENSMUSG00000047495

Gene Name

DLG associated protein 2

Synonyms

PSD-95/SAP90-binding protein 2, DAP2, Sapap2, 6430596N04Rik, SAP90/PSD-95-associated protein 2

MMRRC Submission

041764-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4521 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14095865-14847680 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 14727871 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 372 (R372H)

Ref Sequence

ENSEMBL: ENSMUSP00000123078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043279] [ENSMUST00000133298] [ENSMUST00000150247] [ENSMUST00000152652]

AlphaFold

Q8BJ42

Predicted Effect

probably damaging
Transcript: ENSMUST00000043279
AA Change: R371H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039647
Gene: ENSMUSG00000047495
AA Change: R371H

Domain	Start	End	E-Value	Type
low complexity region	269	294	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	446	456	N/A	INTRINSIC
low complexity region	543	556	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
Pfam:GKAP	707	1059	1.5e-151	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000133298
AA Change: R371H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119613
Gene: ENSMUSG00000047495
AA Change: R371H

Domain	Start	End	E-Value	Type
low complexity region	269	294	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	446	456	N/A	INTRINSIC
low complexity region	543	556	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
Pfam:GKAP	707	1059	1.5e-151	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141214

Predicted Effect

probably damaging
Transcript: ENSMUST00000150247
AA Change: R371H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123104
Gene: ENSMUSG00000047495
AA Change: R371H

Domain	Start	End	E-Value	Type
low complexity region	269	294	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	446	456	N/A	INTRINSIC
low complexity region	543	556	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
Pfam:GKAP	707	1045	1e-151	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000152652
AA Change: R372H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123078
Gene: ENSMUSG00000047495
AA Change: R372H

Domain	Start	End	E-Value	Type
low complexity region	270	295	N/A	INTRINSIC
low complexity region	298	311	N/A	INTRINSIC
low complexity region	447	457	N/A	INTRINSIC
low complexity region	544	557	N/A	INTRINSIC
low complexity region	615	629	N/A	INTRINSIC
Pfam:GKAP	715	1060	1.9e-160	PFAM

Meta Mutation Damage Score

0.2916

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2014]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	A	G	10: 50,660,670	N700D	probably benign	Het
Bora	G	T	14: 99,068,548	S451I	probably damaging	Het
Cadm3	A	T	1: 173,345,063		probably null	Het
Car14	A	G	3: 95,904,378		probably benign	Het
Ccdc88c	G	T	12: 100,913,332	S1843R	possibly damaging	Het
Cdc20b	A	G	13: 113,081,191	I381M	probably damaging	Het
Col12a1	C	T	9: 79,633,357	V2449I	probably benign	Het
Crb2	T	C	2: 37,795,337		probably benign	Het
Dcaf6	A	T	1: 165,390,490	D347E	probably damaging	Het
Fat3	T	C	9: 15,922,942	N4118S	probably null	Het
Fbxo41	A	G	6: 85,484,042	I228T	probably damaging	Het
Fpr2	A	C	17: 17,893,247	R168S	probably benign	Het
Ghr	A	G	15: 3,325,958	I281T	probably damaging	Het
Glmp	C	A	3: 88,328,039	N259K	possibly damaging	Het
Grhl3	T	C	4: 135,546,250	K564E	probably damaging	Het
Helz2	T	C	2: 181,228,833	H2875R	probably benign	Het
Lcp1	A	G	14: 75,215,168	D438G	possibly damaging	Het
Lrfn2	T	A	17: 49,069,894	M1K	probably null	Het
Lrp6	A	G	6: 134,485,862	C612R	probably damaging	Het
Map3k13	T	C	16: 21,905,775	V341A	possibly damaging	Het
Megf8	T	A	7: 25,342,701	C1315S	probably benign	Het
Mrgpra9	A	T	7: 47,235,190	L243H	probably damaging	Het
Mrgprx1	T	C	7: 48,021,699	D100G	probably benign	Het
Nop2	G	T	6: 125,133,552	R47L	probably damaging	Het
Nup93	T	C	8: 94,314,636	Y801H	probably damaging	Het
Olfr623	C	T	7: 103,660,332	R306H	probably benign	Het
Olfr810	T	A	10: 129,791,181	N136I	possibly damaging	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Plce1	T	C	19: 38,524,319	S21P	possibly damaging	Het
Plpp2	A	G	10: 79,530,625	Y118H	probably damaging	Het
Ppwd1	A	G	13: 104,209,659	V496A	probably benign	Het
Rbm20	A	G	19: 53,817,202	N466S	probably benign	Het
Rpl10l	T	C	12: 66,283,738	D207G	probably benign	Het
Skida1	T	C	2: 18,045,872		probably benign	Het
Stk17b	A	G	1: 53,764,038	Y73H	probably damaging	Het
Tapbpl	A	G	6: 125,228,122	I287T	probably damaging	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Topbp1	T	C	9: 103,334,202		probably benign	Het
Tsen54	G	A	11: 115,817,106		probably null	Het
Ttn	G	A	2: 76,725,216	R28736*	probably null	Het
Wdr36	G	A	18: 32,841,148		probably null	Het

Other mutations in Dlgap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01476:Dlgap2	APN	8	14778301	nonsense	probably null
IGL01788:Dlgap2	APN	8	14843631	missense	probably benign	0.19
IGL02054:Dlgap2	APN	8	14843552	missense	probably damaging	0.98
IGL02969:Dlgap2	APN	8	14831579	missense	possibly damaging	0.95
IGL03183:Dlgap2	APN	8	14727525	missense	possibly damaging	0.62
IGL03303:Dlgap2	APN	8	14727812	missense	probably damaging	0.99
G1Funyon:Dlgap2	UTSW	8	14823577	missense	probably benign	0.27
PIT4403001:Dlgap2	UTSW	8	14831528	missense	probably damaging	1.00
R0026:Dlgap2	UTSW	8	14727363	nonsense	probably null
R0242:Dlgap2	UTSW	8	14727562	missense	probably benign	0.34
R0242:Dlgap2	UTSW	8	14727562	missense	probably benign	0.34
R0647:Dlgap2	UTSW	8	14727591	missense	possibly damaging	0.95
R1221:Dlgap2	UTSW	8	14726952	missense	probably benign	0.08
R1374:Dlgap2	UTSW	8	14831228	splice site	probably benign
R1440:Dlgap2	UTSW	8	14727060	missense	probably benign
R1544:Dlgap2	UTSW	8	14829861	splice site	probably null
R1550:Dlgap2	UTSW	8	14822499	missense	probably damaging	0.98
R1804:Dlgap2	UTSW	8	14727809	missense	possibly damaging	0.71
R1870:Dlgap2	UTSW	8	14773347	missense	probably damaging	1.00
R1921:Dlgap2	UTSW	8	14843624	missense	probably benign	0.10
R2119:Dlgap2	UTSW	8	14778206	missense	possibly damaging	0.69
R2193:Dlgap2	UTSW	8	14743431	missense	possibly damaging	0.51
R4381:Dlgap2	UTSW	8	14846502	missense	probably benign
R4422:Dlgap2	UTSW	8	14743463	critical splice donor site	probably null
R4581:Dlgap2	UTSW	8	14846679	missense	probably damaging	1.00
R4585:Dlgap2	UTSW	8	14727999	critical splice donor site	probably null
R4760:Dlgap2	UTSW	8	14773380	missense	probably damaging	1.00
R5077:Dlgap2	UTSW	8	14822691	missense	probably benign	0.35
R5373:Dlgap2	UTSW	8	14823614	missense	probably benign	0.19
R5374:Dlgap2	UTSW	8	14823614	missense	probably benign	0.19
R5552:Dlgap2	UTSW	8	14831342	nonsense	probably null
R5964:Dlgap2	UTSW	8	14727128	nonsense	probably null
R6125:Dlgap2	UTSW	8	14727193	missense	possibly damaging	0.78
R6147:Dlgap2	UTSW	8	14727294	missense	probably benign	0.05
R6163:Dlgap2	UTSW	8	14846641	missense	probably damaging	1.00
R6269:Dlgap2	UTSW	8	14822369	missense	probably benign	0.01
R6629:Dlgap2	UTSW	8	14831465	missense	probably benign	0.00
R6765:Dlgap2	UTSW	8	14743284	missense	probably benign	0.00
R6809:Dlgap2	UTSW	8	14179619	intron	probably benign
R6913:Dlgap2	UTSW	8	14778374	missense	probably benign	0.10
R7219:Dlgap2	UTSW	8	14743296	missense	probably benign	0.00
R7485:Dlgap2	UTSW	8	14829952	missense	probably damaging	0.97
R7560:Dlgap2	UTSW	8	14822697	critical splice donor site	probably null
R7826:Dlgap2	UTSW	8	14743410	missense	probably benign	0.38
R7976:Dlgap2	UTSW	8	14743410	missense	probably benign	0.38
R8101:Dlgap2	UTSW	8	14831600	missense	probably benign	0.04
R8301:Dlgap2	UTSW	8	14823577	missense	probably benign	0.27
R8333:Dlgap2	UTSW	8	14778295	missense	probably benign	0.03
R8367:Dlgap2	UTSW	8	14843544	missense	probably benign	0.00
R8492:Dlgap2	UTSW	8	14778271	missense	possibly damaging	0.49
R8685:Dlgap2	UTSW	8	14831628	missense	possibly damaging	0.71
R8690:Dlgap2	UTSW	8	14743430	missense	probably benign	0.00
R8887:Dlgap2	UTSW	8	14179682	critical splice donor site	probably null
R9328:Dlgap2	UTSW	8	14727441	missense	probably damaging	1.00
R9338:Dlgap2	UTSW	8	14179683	critical splice donor site	probably null
R9465:Dlgap2	UTSW	8	14778226	missense	probably damaging	1.00
R9680:Dlgap2	UTSW	8	14846653	missense	probably damaging	0.98
X0060:Dlgap2	UTSW	8	14839787	missense	probably damaging	1.00
Z1088:Dlgap2	UTSW	8	14822472	missense	probably benign	0.10
Z1177:Dlgap2	UTSW	8	14727659	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACAAGTCTGGTATGAGCAG -3'
(R):5'- GGTACAACCTTCCGCACAAG -3'

Sequencing Primer
(F):5'- TTCTGACGACAACCTGGACAGTG -3'
(R):5'- GGACACAGTTACCTGAGCCTTAC -3'

Posted On

2015-08-18