Incidental Mutation 'R4521:Dlgap2'
ID 334224
Institutional Source Beutler Lab
Gene Symbol Dlgap2
Ensembl Gene ENSMUSG00000047495
Gene Name DLG associated protein 2
Synonyms 6430596N04Rik, PSD-95/SAP90-binding protein 2, Sapap2, DAP2, SAP90/PSD-95-associated protein 2
MMRRC Submission 041764-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4521 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 14145865-14897680 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 14777871 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 372 (R372H)
Ref Sequence ENSEMBL: ENSMUSP00000123078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043279] [ENSMUST00000133298] [ENSMUST00000150247] [ENSMUST00000152652]
AlphaFold Q8BJ42
Predicted Effect probably damaging
Transcript: ENSMUST00000043279
AA Change: R371H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039647
Gene: ENSMUSG00000047495
AA Change: R371H

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133298
AA Change: R371H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119613
Gene: ENSMUSG00000047495
AA Change: R371H

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141214
Predicted Effect probably damaging
Transcript: ENSMUST00000150247
AA Change: R371H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123104
Gene: ENSMUSG00000047495
AA Change: R371H

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1045 1e-151 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152652
AA Change: R372H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123078
Gene: ENSMUSG00000047495
AA Change: R372H

DomainStartEndE-ValueType
low complexity region 270 295 N/A INTRINSIC
low complexity region 298 311 N/A INTRINSIC
low complexity region 447 457 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:GKAP 715 1060 1.9e-160 PFAM
Meta Mutation Damage Score 0.2916 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,536,766 (GRCm39) N700D probably benign Het
Bora G T 14: 99,305,984 (GRCm39) S451I probably damaging Het
Cadm3 A T 1: 173,172,630 (GRCm39) probably null Het
Car14 A G 3: 95,811,690 (GRCm39) probably benign Het
Ccdc88c G T 12: 100,879,591 (GRCm39) S1843R possibly damaging Het
Cdc20b A G 13: 113,217,725 (GRCm39) I381M probably damaging Het
Col12a1 C T 9: 79,540,639 (GRCm39) V2449I probably benign Het
Crb2 T C 2: 37,685,349 (GRCm39) probably benign Het
Dcaf6 A T 1: 165,218,059 (GRCm39) D347E probably damaging Het
Fat3 T C 9: 15,834,238 (GRCm39) N4118S probably null Het
Fbxo41 A G 6: 85,461,024 (GRCm39) I228T probably damaging Het
Fpr2 A C 17: 18,113,509 (GRCm39) R168S probably benign Het
Ghr A G 15: 3,355,440 (GRCm39) I281T probably damaging Het
Glmp C A 3: 88,235,346 (GRCm39) N259K possibly damaging Het
Grhl3 T C 4: 135,273,561 (GRCm39) K564E probably damaging Het
Helz2 T C 2: 180,870,626 (GRCm39) H2875R probably benign Het
Lcp1 A G 14: 75,452,608 (GRCm39) D438G possibly damaging Het
Lrfn2 T A 17: 49,376,922 (GRCm39) M1K probably null Het
Lrp6 A G 6: 134,462,825 (GRCm39) C612R probably damaging Het
Map3k13 T C 16: 21,724,525 (GRCm39) V341A possibly damaging Het
Megf8 T A 7: 25,042,126 (GRCm39) C1315S probably benign Het
Mrgpra9 A T 7: 46,884,938 (GRCm39) L243H probably damaging Het
Mrgprx1 T C 7: 47,671,447 (GRCm39) D100G probably benign Het
Nop2 G T 6: 125,110,515 (GRCm39) R47L probably damaging Het
Nup93 T C 8: 95,041,264 (GRCm39) Y801H probably damaging Het
Or51b6b C T 7: 103,309,539 (GRCm39) R306H probably benign Het
Or6c69b T A 10: 129,627,050 (GRCm39) N136I possibly damaging Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Plce1 T C 19: 38,512,763 (GRCm39) S21P possibly damaging Het
Plpp2 A G 10: 79,366,459 (GRCm39) Y118H probably damaging Het
Ppwd1 A G 13: 104,346,167 (GRCm39) V496A probably benign Het
Rbm20 A G 19: 53,805,633 (GRCm39) N466S probably benign Het
Rpl10l T C 12: 66,330,512 (GRCm39) D207G probably benign Het
Skida1 T C 2: 18,050,683 (GRCm39) probably benign Het
Stk17b A G 1: 53,803,197 (GRCm39) Y73H probably damaging Het
Tapbpl A G 6: 125,205,085 (GRCm39) I287T probably damaging Het
Tmem38a C T 8: 73,326,005 (GRCm39) P20S possibly damaging Het
Topbp1 T C 9: 103,211,401 (GRCm39) probably benign Het
Tsen54 G A 11: 115,707,932 (GRCm39) probably null Het
Ttn G A 2: 76,555,560 (GRCm39) R28736* probably null Het
Wdr36 G A 18: 32,974,201 (GRCm39) probably null Het
Other mutations in Dlgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Dlgap2 APN 8 14,828,301 (GRCm39) nonsense probably null
IGL01788:Dlgap2 APN 8 14,893,631 (GRCm39) missense probably benign 0.19
IGL02054:Dlgap2 APN 8 14,893,552 (GRCm39) missense probably damaging 0.98
IGL02969:Dlgap2 APN 8 14,881,579 (GRCm39) missense possibly damaging 0.95
IGL03183:Dlgap2 APN 8 14,777,525 (GRCm39) missense possibly damaging 0.62
IGL03303:Dlgap2 APN 8 14,777,812 (GRCm39) missense probably damaging 0.99
G1Funyon:Dlgap2 UTSW 8 14,873,577 (GRCm39) missense probably benign 0.27
PIT4403001:Dlgap2 UTSW 8 14,881,528 (GRCm39) missense probably damaging 1.00
R0026:Dlgap2 UTSW 8 14,777,363 (GRCm39) nonsense probably null
R0242:Dlgap2 UTSW 8 14,777,562 (GRCm39) missense probably benign 0.34
R0242:Dlgap2 UTSW 8 14,777,562 (GRCm39) missense probably benign 0.34
R0647:Dlgap2 UTSW 8 14,777,591 (GRCm39) missense possibly damaging 0.95
R1221:Dlgap2 UTSW 8 14,776,952 (GRCm39) missense probably benign 0.08
R1374:Dlgap2 UTSW 8 14,881,228 (GRCm39) splice site probably benign
R1440:Dlgap2 UTSW 8 14,777,060 (GRCm39) missense probably benign
R1544:Dlgap2 UTSW 8 14,879,861 (GRCm39) splice site probably null
R1550:Dlgap2 UTSW 8 14,872,499 (GRCm39) missense probably damaging 0.98
R1804:Dlgap2 UTSW 8 14,777,809 (GRCm39) missense possibly damaging 0.71
R1870:Dlgap2 UTSW 8 14,823,347 (GRCm39) missense probably damaging 1.00
R1921:Dlgap2 UTSW 8 14,893,624 (GRCm39) missense probably benign 0.10
R2119:Dlgap2 UTSW 8 14,828,206 (GRCm39) missense possibly damaging 0.69
R2193:Dlgap2 UTSW 8 14,793,431 (GRCm39) missense possibly damaging 0.51
R4381:Dlgap2 UTSW 8 14,896,502 (GRCm39) missense probably benign
R4422:Dlgap2 UTSW 8 14,793,463 (GRCm39) critical splice donor site probably null
R4581:Dlgap2 UTSW 8 14,896,679 (GRCm39) missense probably damaging 1.00
R4585:Dlgap2 UTSW 8 14,777,999 (GRCm39) critical splice donor site probably null
R4760:Dlgap2 UTSW 8 14,823,380 (GRCm39) missense probably damaging 1.00
R5077:Dlgap2 UTSW 8 14,872,691 (GRCm39) missense probably benign 0.35
R5373:Dlgap2 UTSW 8 14,873,614 (GRCm39) missense probably benign 0.19
R5374:Dlgap2 UTSW 8 14,873,614 (GRCm39) missense probably benign 0.19
R5552:Dlgap2 UTSW 8 14,881,342 (GRCm39) nonsense probably null
R5964:Dlgap2 UTSW 8 14,777,128 (GRCm39) nonsense probably null
R6125:Dlgap2 UTSW 8 14,777,193 (GRCm39) missense possibly damaging 0.78
R6147:Dlgap2 UTSW 8 14,777,294 (GRCm39) missense probably benign 0.05
R6163:Dlgap2 UTSW 8 14,896,641 (GRCm39) missense probably damaging 1.00
R6269:Dlgap2 UTSW 8 14,872,369 (GRCm39) missense probably benign 0.01
R6629:Dlgap2 UTSW 8 14,881,465 (GRCm39) missense probably benign 0.00
R6765:Dlgap2 UTSW 8 14,793,284 (GRCm39) missense probably benign 0.00
R6809:Dlgap2 UTSW 8 14,229,619 (GRCm39) intron probably benign
R6913:Dlgap2 UTSW 8 14,828,374 (GRCm39) missense probably benign 0.10
R7219:Dlgap2 UTSW 8 14,793,296 (GRCm39) missense probably benign 0.00
R7485:Dlgap2 UTSW 8 14,879,952 (GRCm39) missense probably damaging 0.97
R7560:Dlgap2 UTSW 8 14,872,697 (GRCm39) critical splice donor site probably null
R7826:Dlgap2 UTSW 8 14,793,410 (GRCm39) missense probably benign 0.38
R7976:Dlgap2 UTSW 8 14,793,410 (GRCm39) missense probably benign 0.38
R8101:Dlgap2 UTSW 8 14,881,600 (GRCm39) missense probably benign 0.04
R8301:Dlgap2 UTSW 8 14,873,577 (GRCm39) missense probably benign 0.27
R8333:Dlgap2 UTSW 8 14,828,295 (GRCm39) missense probably benign 0.03
R8367:Dlgap2 UTSW 8 14,893,544 (GRCm39) missense probably benign 0.00
R8492:Dlgap2 UTSW 8 14,828,271 (GRCm39) missense possibly damaging 0.49
R8685:Dlgap2 UTSW 8 14,881,628 (GRCm39) missense possibly damaging 0.71
R8690:Dlgap2 UTSW 8 14,793,430 (GRCm39) missense probably benign 0.00
R8887:Dlgap2 UTSW 8 14,229,682 (GRCm39) critical splice donor site probably null
R9328:Dlgap2 UTSW 8 14,777,441 (GRCm39) missense probably damaging 1.00
R9338:Dlgap2 UTSW 8 14,229,683 (GRCm39) critical splice donor site probably null
R9465:Dlgap2 UTSW 8 14,828,226 (GRCm39) missense probably damaging 1.00
R9680:Dlgap2 UTSW 8 14,896,653 (GRCm39) missense probably damaging 0.98
X0060:Dlgap2 UTSW 8 14,889,787 (GRCm39) missense probably damaging 1.00
Z1088:Dlgap2 UTSW 8 14,872,472 (GRCm39) missense probably benign 0.10
Z1177:Dlgap2 UTSW 8 14,777,659 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAAGTCTGGTATGAGCAG -3'
(R):5'- GGTACAACCTTCCGCACAAG -3'

Sequencing Primer
(F):5'- TTCTGACGACAACCTGGACAGTG -3'
(R):5'- GGACACAGTTACCTGAGCCTTAC -3'
Posted On 2015-08-18