Incidental Mutation 'R4521:Tmem38a'
List |< first << previous [record 38 of 42] next >> last >|
ID334225
Institutional Source Beutler Lab
Gene Symbol Tmem38a
Ensembl Gene ENSMUSG00000031791
Gene Nametransmembrane protein 38A
Synonyms1110001E17Rik, TRIC-A
MMRRC Submission 041764-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4521 (G1)
Quality Score172
Status Validated
Chromosome8
Chromosomal Location72572055-72587282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72572161 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 20 (P20S)
Ref Sequence ENSEMBL: ENSMUSP00000148844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034244] [ENSMUST00000058733] [ENSMUST00000167290] [ENSMUST00000211914] [ENSMUST00000212763]
Predicted Effect probably benign
Transcript: ENSMUST00000034244
AA Change: P20S

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034244
Gene: ENSMUSG00000031791
AA Change: P20S

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:TRIC 40 231 5.5e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058733
SMART Domains Protein: ENSMUSP00000059943
Gene: ENSMUSG00000044600

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163745
Predicted Effect probably benign
Transcript: ENSMUST00000167290
SMART Domains Protein: ENSMUSP00000127441
Gene: ENSMUSG00000044600

DomainStartEndE-ValueType
transmembrane domain 5 23 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000211914
AA Change: P20S

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212763
AA Change: P20S

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Bora G T 14: 99,068,548 S451I probably damaging Het
Cadm3 A T 1: 173,345,063 probably null Het
Car14 A G 3: 95,904,378 probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdc20b A G 13: 113,081,191 I381M probably damaging Het
Col12a1 C T 9: 79,633,357 V2449I probably benign Het
Crb2 T C 2: 37,795,337 probably benign Het
Dcaf6 A T 1: 165,390,490 D347E probably damaging Het
Dlgap2 G A 8: 14,727,871 R372H probably damaging Het
Fat3 T C 9: 15,922,942 N4118S probably null Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fpr2 A C 17: 17,893,247 R168S probably benign Het
Ghr A G 15: 3,325,958 I281T probably damaging Het
Glmp C A 3: 88,328,039 N259K possibly damaging Het
Grhl3 T C 4: 135,546,250 K564E probably damaging Het
Helz2 T C 2: 181,228,833 H2875R probably benign Het
Lcp1 A G 14: 75,215,168 D438G possibly damaging Het
Lrfn2 T A 17: 49,069,894 M1K probably null Het
Lrp6 A G 6: 134,485,862 C612R probably damaging Het
Map3k13 T C 16: 21,905,775 V341A possibly damaging Het
Megf8 T A 7: 25,342,701 C1315S probably benign Het
Mrgpra9 A T 7: 47,235,190 L243H probably damaging Het
Mrgprx1 T C 7: 48,021,699 D100G probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nup93 T C 8: 94,314,636 Y801H probably damaging Het
Olfr623 C T 7: 103,660,332 R306H probably benign Het
Olfr810 T A 10: 129,791,181 N136I possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Plpp2 A G 10: 79,530,625 Y118H probably damaging Het
Ppwd1 A G 13: 104,209,659 V496A probably benign Het
Rbm20 A G 19: 53,817,202 N466S probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Skida1 T C 2: 18,045,872 probably benign Het
Stk17b A G 1: 53,764,038 Y73H probably damaging Het
Tapbpl A G 6: 125,228,122 I287T probably damaging Het
Topbp1 T C 9: 103,334,202 probably benign Het
Tsen54 G A 11: 115,817,106 probably null Het
Ttn G A 2: 76,725,216 R28736* probably null Het
Wdr36 G A 18: 32,841,148 probably null Het
Other mutations in Tmem38a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:Tmem38a APN 8 72579974 missense probably damaging 0.99
IGL02715:Tmem38a APN 8 72579668 missense possibly damaging 0.69
IGL02967:Tmem38a APN 8 72586082 missense possibly damaging 0.95
R0631:Tmem38a UTSW 8 72580018 missense probably benign 0.05
R1073:Tmem38a UTSW 8 72580103 missense probably damaging 1.00
R1161:Tmem38a UTSW 8 72579970 missense probably damaging 1.00
R1310:Tmem38a UTSW 8 72579970 missense probably damaging 1.00
R1489:Tmem38a UTSW 8 72579635 missense probably damaging 1.00
R2040:Tmem38a UTSW 8 72581252 missense probably damaging 1.00
R4508:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4515:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4517:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4522:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4529:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4867:Tmem38a UTSW 8 72581233 missense possibly damaging 0.80
R5200:Tmem38a UTSW 8 72580034 missense probably damaging 1.00
R5807:Tmem38a UTSW 8 72580100 missense probably damaging 1.00
R5882:Tmem38a UTSW 8 72585887 missense probably damaging 1.00
R7803:Tmem38a UTSW 8 72572120 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAACGAGTTCTGACGTCCC -3'
(R):5'- AACAAGAGCGCTCCTTTTCTTC -3'

Sequencing Primer
(F):5'- TACGGCCCCGCATTTTGG -3'
(R):5'- GAGCACTCCACGATCTCAG -3'
Posted On2015-08-18