Mutagenetix > Incidental Mutations

Incidental Mutation 'R4521:Topbp1'

334229

Institutional Source

Beutler Lab

Gene Symbol

Topbp1

Ensembl Gene

ENSMUSG00000032555

Gene Name

topoisomerase (DNA) II binding protein 1

Synonyms

D430026L04Rik, 2810429C13Rik, 1110031N14Rik

MMRRC Submission

041764-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4521 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103305215-103350428 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 103334202 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035164]

Predicted Effect

probably benign
Transcript: ENSMUST00000035164

SMART Domains

Protein: ENSMUSP00000035164
Gene: ENSMUSG00000032555

Domain	Start	End	E-Value	Type
BRCT	6	91	3.04e1	SMART
BRCT	103	179	1.51e-13	SMART
BRCT	197	274	4.69e-19	SMART
BRCT	355	433	3.58e-15	SMART
BRCT	553	626	5.57e-3	SMART
BRCT	646	731	1.53e-9	SMART
BRCT	904	983	3.48e-13	SMART
low complexity region	1097	1106	N/A	INTRINSIC
low complexity region	1110	1121	N/A	INTRINSIC
low complexity region	1213	1218	N/A	INTRINSIC
BRCT	1258	1337	2.31e-9	SMART
Blast:BRCT	1387	1472	4e-52	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000185721

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186897

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188840

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a binding protein which interacts with the C-terminal region of topoisomerase II beta. This interaction suggests a supportive role for this protein in the catalytic reactions of topoisomerase II beta through transient breakages of DNA strands. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die around implantation due to embryonic growth arrest, increased apoptosis, and decreased cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	A	G	10: 50,660,670	N700D	probably benign	Het
Bora	G	T	14: 99,068,548	S451I	probably damaging	Het
Cadm3	A	T	1: 173,345,063		probably null	Het
Car14	A	G	3: 95,904,378		probably benign	Het
Ccdc88c	G	T	12: 100,913,332	S1843R	possibly damaging	Het
Cdc20b	A	G	13: 113,081,191	I381M	probably damaging	Het
Col12a1	C	T	9: 79,633,357	V2449I	probably benign	Het
Crb2	T	C	2: 37,795,337		probably benign	Het
Dcaf6	A	T	1: 165,390,490	D347E	probably damaging	Het
Dlgap2	G	A	8: 14,727,871	R372H	probably damaging	Het
Fat3	T	C	9: 15,922,942	N4118S	probably null	Het
Fbxo41	A	G	6: 85,484,042	I228T	probably damaging	Het
Fpr2	A	C	17: 17,893,247	R168S	probably benign	Het
Ghr	A	G	15: 3,325,958	I281T	probably damaging	Het
Glmp	C	A	3: 88,328,039	N259K	possibly damaging	Het
Grhl3	T	C	4: 135,546,250	K564E	probably damaging	Het
Helz2	T	C	2: 181,228,833	H2875R	probably benign	Het
Lcp1	A	G	14: 75,215,168	D438G	possibly damaging	Het
Lrfn2	T	A	17: 49,069,894	M1K	probably null	Het
Lrp6	A	G	6: 134,485,862	C612R	probably damaging	Het
Map3k13	T	C	16: 21,905,775	V341A	possibly damaging	Het
Megf8	T	A	7: 25,342,701	C1315S	probably benign	Het
Mrgpra9	A	T	7: 47,235,190	L243H	probably damaging	Het
Mrgprx1	T	C	7: 48,021,699	D100G	probably benign	Het
Nop2	G	T	6: 125,133,552	R47L	probably damaging	Het
Nup93	T	C	8: 94,314,636	Y801H	probably damaging	Het
Olfr623	C	T	7: 103,660,332	R306H	probably benign	Het
Olfr810	T	A	10: 129,791,181	N136I	possibly damaging	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Plce1	T	C	19: 38,524,319	S21P	possibly damaging	Het
Plpp2	A	G	10: 79,530,625	Y118H	probably damaging	Het
Ppwd1	A	G	13: 104,209,659	V496A	probably benign	Het
Rbm20	A	G	19: 53,817,202	N466S	probably benign	Het
Rpl10l	T	C	12: 66,283,738	D207G	probably benign	Het
Skida1	T	C	2: 18,045,872		probably benign	Het
Stk17b	A	G	1: 53,764,038	Y73H	probably damaging	Het
Tapbpl	A	G	6: 125,228,122	I287T	probably damaging	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Tsen54	G	A	11: 115,817,106		probably null	Het
Ttn	G	A	2: 76,725,216	R28736*	probably null	Het
Wdr36	G	A	18: 32,841,148		probably null	Het

Other mutations in Topbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Topbp1	APN	9	103344943	missense	probably benign
IGL01524:Topbp1	APN	9	103311645	missense	possibly damaging	0.92
IGL02335:Topbp1	APN	9	103328523	missense	probably damaging	1.00
IGL02441:Topbp1	APN	9	103320239	missense	possibly damaging	0.49
IGL02943:Topbp1	APN	9	103328440	missense	probably benign	0.00
IGL02953:Topbp1	APN	9	103328435	missense	probably benign	0.26
IGL03040:Topbp1	APN	9	103328667	missense	possibly damaging	0.51
PIT4377001:Topbp1	UTSW	9	103309889	missense	possibly damaging	0.90
R0044:Topbp1	UTSW	9	103325773	missense	possibly damaging	0.94
R0344:Topbp1	UTSW	9	103328687	missense	probably damaging	0.99
R0344:Topbp1	UTSW	9	103308733	splice site	probably benign
R0591:Topbp1	UTSW	9	103349838	missense	probably benign	0.01
R0666:Topbp1	UTSW	9	103308812	missense	probably benign
R0785:Topbp1	UTSW	9	103315090	missense	probably damaging	1.00
R0906:Topbp1	UTSW	9	103328593	missense	probably benign	0.00
R1352:Topbp1	UTSW	9	103347008	missense	probably benign
R1745:Topbp1	UTSW	9	103308845	missense	probably benign	0.36
R2104:Topbp1	UTSW	9	103317982	splice site	probably benign
R2166:Topbp1	UTSW	9	103312929	unclassified	probably null
R2230:Topbp1	UTSW	9	103345848	missense	probably damaging	1.00
R2967:Topbp1	UTSW	9	103342140	missense	probably benign	0.01
R3845:Topbp1	UTSW	9	103309923	missense	possibly damaging	0.87
R4089:Topbp1	UTSW	9	103324501	critical splice donor site	probably null
R4110:Topbp1	UTSW	9	103309959	missense	probably damaging	0.98
R4454:Topbp1	UTSW	9	103344871	missense	probably damaging	1.00
R4745:Topbp1	UTSW	9	103323571	missense	probably damaging	1.00
R4923:Topbp1	UTSW	9	103312836	missense	probably benign	0.00
R4934:Topbp1	UTSW	9	103328369	unclassified	probably benign
R4963:Topbp1	UTSW	9	103320605	missense	probably benign	0.04
R5199:Topbp1	UTSW	9	103346672	unclassified	probably benign
R5461:Topbp1	UTSW	9	103315196	missense	probably benign	0.00
R5517:Topbp1	UTSW	9	103336114	missense	probably benign	0.03
R5563:Topbp1	UTSW	9	103311513	missense	possibly damaging	0.46
R5564:Topbp1	UTSW	9	103334078	missense	probably damaging	1.00
R5683:Topbp1	UTSW	9	103312804	missense	possibly damaging	0.93
R5774:Topbp1	UTSW	9	103328499	missense	probably benign	0.06
R5785:Topbp1	UTSW	9	103323528	missense	probably benign	0.00
R6029:Topbp1	UTSW	9	103344953	missense	probably benign	0.00
R6077:Topbp1	UTSW	9	103332990	missense	probably damaging	1.00
R6122:Topbp1	UTSW	9	103346961	missense	probably benign	0.06
R6133:Topbp1	UTSW	9	103311764	unclassified	probably null
R6213:Topbp1	UTSW	9	103332751	missense	probably benign	0.12
R6773:Topbp1	UTSW	9	103343692	missense	possibly damaging	0.90
R6922:Topbp1	UTSW	9	103335846	missense	probably damaging	1.00
R6938:Topbp1	UTSW	9	103328554	missense	probably damaging	1.00
R7305:Topbp1	UTSW	9	103328637	missense	probably damaging	1.00
R7419:Topbp1	UTSW	9	103323344	missense	probably benign
R7517:Topbp1	UTSW	9	103332733	missense	possibly damaging	0.82
R7605:Topbp1	UTSW	9	103332706	missense	probably benign	0.41
R7701:Topbp1	UTSW	9	103332985	missense	probably damaging	0.96
R7741:Topbp1	UTSW	9	103320557	missense	probably damaging	0.97
R8115:Topbp1	UTSW	9	103320541	missense	probably benign
R8177:Topbp1	UTSW	9	103320541	missense	probably benign	0.01
R8269:Topbp1	UTSW	9	103328593	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- GAGTAGACTGCTGTTTCCCTTAG -3'
(R):5'- GTTCCCATGGCATCCAACAG -3'

Sequencing Primer
(F):5'- AGACTGCTGTTTCCCTTAGTTATTC -3'
(R):5'- TGTGCCCTGGACAGCAGTC -3'

Posted On

2015-08-18