Incidental Mutation 'R4521:Topbp1'
List |< first << previous [record 39 of 42] next >> last >|
ID334229
Institutional Source Beutler Lab
Gene Symbol Topbp1
Ensembl Gene ENSMUSG00000032555
Gene Nametopoisomerase (DNA) II binding protein 1
SynonymsD430026L04Rik, 2810429C13Rik, 1110031N14Rik
MMRRC Submission 041764-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4521 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location103305215-103350428 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 103334202 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000035164]
Predicted Effect probably benign
Transcript: ENSMUST00000035164
SMART Domains Protein: ENSMUSP00000035164
Gene: ENSMUSG00000032555

DomainStartEndE-ValueType
BRCT 6 91 3.04e1 SMART
BRCT 103 179 1.51e-13 SMART
BRCT 197 274 4.69e-19 SMART
BRCT 355 433 3.58e-15 SMART
BRCT 553 626 5.57e-3 SMART
BRCT 646 731 1.53e-9 SMART
BRCT 904 983 3.48e-13 SMART
low complexity region 1097 1106 N/A INTRINSIC
low complexity region 1110 1121 N/A INTRINSIC
low complexity region 1213 1218 N/A INTRINSIC
BRCT 1258 1337 2.31e-9 SMART
Blast:BRCT 1387 1472 4e-52 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000185721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188840
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a binding protein which interacts with the C-terminal region of topoisomerase II beta. This interaction suggests a supportive role for this protein in the catalytic reactions of topoisomerase II beta through transient breakages of DNA strands. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die around implantation due to embryonic growth arrest, increased apoptosis, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Bora G T 14: 99,068,548 S451I probably damaging Het
Cadm3 A T 1: 173,345,063 probably null Het
Car14 A G 3: 95,904,378 probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdc20b A G 13: 113,081,191 I381M probably damaging Het
Col12a1 C T 9: 79,633,357 V2449I probably benign Het
Crb2 T C 2: 37,795,337 probably benign Het
Dcaf6 A T 1: 165,390,490 D347E probably damaging Het
Dlgap2 G A 8: 14,727,871 R372H probably damaging Het
Fat3 T C 9: 15,922,942 N4118S probably null Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fpr2 A C 17: 17,893,247 R168S probably benign Het
Ghr A G 15: 3,325,958 I281T probably damaging Het
Glmp C A 3: 88,328,039 N259K possibly damaging Het
Grhl3 T C 4: 135,546,250 K564E probably damaging Het
Helz2 T C 2: 181,228,833 H2875R probably benign Het
Lcp1 A G 14: 75,215,168 D438G possibly damaging Het
Lrfn2 T A 17: 49,069,894 M1K probably null Het
Lrp6 A G 6: 134,485,862 C612R probably damaging Het
Map3k13 T C 16: 21,905,775 V341A possibly damaging Het
Megf8 T A 7: 25,342,701 C1315S probably benign Het
Mrgpra9 A T 7: 47,235,190 L243H probably damaging Het
Mrgprx1 T C 7: 48,021,699 D100G probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nup93 T C 8: 94,314,636 Y801H probably damaging Het
Olfr623 C T 7: 103,660,332 R306H probably benign Het
Olfr810 T A 10: 129,791,181 N136I possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Plpp2 A G 10: 79,530,625 Y118H probably damaging Het
Ppwd1 A G 13: 104,209,659 V496A probably benign Het
Rbm20 A G 19: 53,817,202 N466S probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Skida1 T C 2: 18,045,872 probably benign Het
Stk17b A G 1: 53,764,038 Y73H probably damaging Het
Tapbpl A G 6: 125,228,122 I287T probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tsen54 G A 11: 115,817,106 probably null Het
Ttn G A 2: 76,725,216 R28736* probably null Het
Wdr36 G A 18: 32,841,148 probably null Het
Other mutations in Topbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Topbp1 APN 9 103344943 missense probably benign
IGL01524:Topbp1 APN 9 103311645 missense possibly damaging 0.92
IGL02335:Topbp1 APN 9 103328523 missense probably damaging 1.00
IGL02441:Topbp1 APN 9 103320239 missense possibly damaging 0.49
IGL02943:Topbp1 APN 9 103328440 missense probably benign 0.00
IGL02953:Topbp1 APN 9 103328435 missense probably benign 0.26
IGL03040:Topbp1 APN 9 103328667 missense possibly damaging 0.51
PIT4377001:Topbp1 UTSW 9 103309889 missense possibly damaging 0.90
R0044:Topbp1 UTSW 9 103325773 missense possibly damaging 0.94
R0344:Topbp1 UTSW 9 103328687 missense probably damaging 0.99
R0344:Topbp1 UTSW 9 103308733 splice site probably benign
R0591:Topbp1 UTSW 9 103349838 missense probably benign 0.01
R0666:Topbp1 UTSW 9 103308812 missense probably benign
R0785:Topbp1 UTSW 9 103315090 missense probably damaging 1.00
R0906:Topbp1 UTSW 9 103328593 missense probably benign 0.00
R1352:Topbp1 UTSW 9 103347008 missense probably benign
R1745:Topbp1 UTSW 9 103308845 missense probably benign 0.36
R2104:Topbp1 UTSW 9 103317982 splice site probably benign
R2166:Topbp1 UTSW 9 103312929 unclassified probably null
R2230:Topbp1 UTSW 9 103345848 missense probably damaging 1.00
R2967:Topbp1 UTSW 9 103342140 missense probably benign 0.01
R3845:Topbp1 UTSW 9 103309923 missense possibly damaging 0.87
R4089:Topbp1 UTSW 9 103324501 critical splice donor site probably null
R4110:Topbp1 UTSW 9 103309959 missense probably damaging 0.98
R4454:Topbp1 UTSW 9 103344871 missense probably damaging 1.00
R4745:Topbp1 UTSW 9 103323571 missense probably damaging 1.00
R4923:Topbp1 UTSW 9 103312836 missense probably benign 0.00
R4934:Topbp1 UTSW 9 103328369 unclassified probably benign
R4963:Topbp1 UTSW 9 103320605 missense probably benign 0.04
R5199:Topbp1 UTSW 9 103346672 unclassified probably benign
R5461:Topbp1 UTSW 9 103315196 missense probably benign 0.00
R5517:Topbp1 UTSW 9 103336114 missense probably benign 0.03
R5563:Topbp1 UTSW 9 103311513 missense possibly damaging 0.46
R5564:Topbp1 UTSW 9 103334078 missense probably damaging 1.00
R5683:Topbp1 UTSW 9 103312804 missense possibly damaging 0.93
R5774:Topbp1 UTSW 9 103328499 missense probably benign 0.06
R5785:Topbp1 UTSW 9 103323528 missense probably benign 0.00
R6029:Topbp1 UTSW 9 103344953 missense probably benign 0.00
R6077:Topbp1 UTSW 9 103332990 missense probably damaging 1.00
R6122:Topbp1 UTSW 9 103346961 missense probably benign 0.06
R6133:Topbp1 UTSW 9 103311764 unclassified probably null
R6213:Topbp1 UTSW 9 103332751 missense probably benign 0.12
R6773:Topbp1 UTSW 9 103343692 missense possibly damaging 0.90
R6922:Topbp1 UTSW 9 103335846 missense probably damaging 1.00
R6938:Topbp1 UTSW 9 103328554 missense probably damaging 1.00
R7305:Topbp1 UTSW 9 103328637 missense probably damaging 1.00
R7419:Topbp1 UTSW 9 103323344 missense probably benign
R7517:Topbp1 UTSW 9 103332733 missense possibly damaging 0.82
R7605:Topbp1 UTSW 9 103332706 missense probably benign 0.41
R7701:Topbp1 UTSW 9 103332985 missense probably damaging 0.96
R7741:Topbp1 UTSW 9 103320557 missense probably damaging 0.97
R8115:Topbp1 UTSW 9 103320541 missense probably benign
R8177:Topbp1 UTSW 9 103320541 missense probably benign 0.01
R8269:Topbp1 UTSW 9 103328593 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GAGTAGACTGCTGTTTCCCTTAG -3'
(R):5'- GTTCCCATGGCATCCAACAG -3'

Sequencing Primer
(F):5'- AGACTGCTGTTTCCCTTAGTTATTC -3'
(R):5'- TGTGCCCTGGACAGCAGTC -3'
Posted On2015-08-18