Incidental Mutation 'R4521:Tsen54'
List |< first << previous [record 40 of 42] next >> last >|
ID334233
Institutional Source Beutler Lab
Gene Symbol Tsen54
Ensembl Gene ENSMUSG00000020781
Gene NametRNA splicing endonuclease subunit 54
Synonyms
MMRRC Submission 041764-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R4521 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115814724-115823094 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 115817106 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021134] [ENSMUST00000041684] [ENSMUST00000106481] [ENSMUST00000136343] [ENSMUST00000136343] [ENSMUST00000154304] [ENSMUST00000156812]
Predicted Effect probably null
Transcript: ENSMUST00000021134
SMART Domains Protein: ENSMUSP00000021134
Gene: ENSMUSG00000020781

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:tRNA_int_end_N2 63 130 1.4e-21 PFAM
low complexity region 196 208 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 314 324 N/A INTRINSIC
coiled coil region 338 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041684
SMART Domains Protein: ENSMUSP00000041328
Gene: ENSMUSG00000034471

DomainStartEndE-ValueType
ANK 2 32 1.27e3 SMART
ANK 48 77 3.01e-4 SMART
ANK 81 110 3.41e-3 SMART
ANK 114 143 1.4e-4 SMART
ANK 147 176 3.26e0 SMART
ANK 188 217 3.33e-6 SMART
ANK 220 249 4.82e-3 SMART
SH3 284 346 1.13e-6 SMART
SAM 485 551 8.53e-12 SMART
SAM 554 621 1.41e-12 SMART
low complexity region 762 774 N/A INTRINSIC
Pfam:Caskin-Pro-rich 793 883 1.4e-32 PFAM
low complexity region 904 921 N/A INTRINSIC
low complexity region 925 944 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1042 1069 N/A INTRINSIC
low complexity region 1084 1090 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
Pfam:Caskin-tail 1144 1201 4.5e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106481
SMART Domains Protein: ENSMUSP00000102090
Gene: ENSMUSG00000020781

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:tRNA_int_end_N2 62 132 1.9e-23 PFAM
low complexity region 196 208 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 314 324 N/A INTRINSIC
coiled coil region 338 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129765
Predicted Effect probably null
Transcript: ENSMUST00000136343
SMART Domains Protein: ENSMUSP00000120506
Gene: ENSMUSG00000020781

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 158 168 N/A INTRINSIC
coiled coil region 182 204 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000136343
SMART Domains Protein: ENSMUSP00000120506
Gene: ENSMUSG00000020781

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 158 168 N/A INTRINSIC
coiled coil region 182 204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141748
Predicted Effect probably benign
Transcript: ENSMUST00000154304
SMART Domains Protein: ENSMUSP00000116955
Gene: ENSMUSG00000020781

DomainStartEndE-ValueType
coiled coil region 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156812
SMART Domains Protein: ENSMUSP00000114310
Gene: ENSMUSG00000034471

DomainStartEndE-ValueType
ANK 2 32 1.27e3 SMART
ANK 48 77 3.01e-4 SMART
ANK 81 110 3.41e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157061
Meta Mutation Damage Score 0.9502 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the tRNA splicing endonuclease complex, which catalyzes the removal of introns from precursor tRNAs. The complex is also implicated in pre-mRNA 3-prime end processing. Mutations in this gene result in pontocerebellar hypoplasia type 2.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Bora G T 14: 99,068,548 S451I probably damaging Het
Cadm3 A T 1: 173,345,063 probably null Het
Car14 A G 3: 95,904,378 probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdc20b A G 13: 113,081,191 I381M probably damaging Het
Col12a1 C T 9: 79,633,357 V2449I probably benign Het
Crb2 T C 2: 37,795,337 probably benign Het
Dcaf6 A T 1: 165,390,490 D347E probably damaging Het
Dlgap2 G A 8: 14,727,871 R372H probably damaging Het
Fat3 T C 9: 15,922,942 N4118S probably null Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fpr2 A C 17: 17,893,247 R168S probably benign Het
Ghr A G 15: 3,325,958 I281T probably damaging Het
Glmp C A 3: 88,328,039 N259K possibly damaging Het
Grhl3 T C 4: 135,546,250 K564E probably damaging Het
Helz2 T C 2: 181,228,833 H2875R probably benign Het
Lcp1 A G 14: 75,215,168 D438G possibly damaging Het
Lrfn2 T A 17: 49,069,894 M1K probably null Het
Lrp6 A G 6: 134,485,862 C612R probably damaging Het
Map3k13 T C 16: 21,905,775 V341A possibly damaging Het
Megf8 T A 7: 25,342,701 C1315S probably benign Het
Mrgpra9 A T 7: 47,235,190 L243H probably damaging Het
Mrgprx1 T C 7: 48,021,699 D100G probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nup93 T C 8: 94,314,636 Y801H probably damaging Het
Olfr623 C T 7: 103,660,332 R306H probably benign Het
Olfr810 T A 10: 129,791,181 N136I possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Plpp2 A G 10: 79,530,625 Y118H probably damaging Het
Ppwd1 A G 13: 104,209,659 V496A probably benign Het
Rbm20 A G 19: 53,817,202 N466S probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Skida1 T C 2: 18,045,872 probably benign Het
Stk17b A G 1: 53,764,038 Y73H probably damaging Het
Tapbpl A G 6: 125,228,122 I287T probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Topbp1 T C 9: 103,334,202 probably benign Het
Ttn G A 2: 76,725,216 R28736* probably null Het
Wdr36 G A 18: 32,841,148 probably null Het
Other mutations in Tsen54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Tsen54 APN 11 115821712 missense possibly damaging 0.90
PIT4486001:Tsen54 UTSW 11 115822596 missense probably damaging 1.00
R0179:Tsen54 UTSW 11 115822030 missense probably damaging 1.00
R0255:Tsen54 UTSW 11 115815408 missense probably damaging 1.00
R0380:Tsen54 UTSW 11 115822597 missense probably damaging 1.00
R0619:Tsen54 UTSW 11 115815064 missense probably damaging 1.00
R0653:Tsen54 UTSW 11 115815061 missense probably damaging 1.00
R1120:Tsen54 UTSW 11 115815013 missense probably damaging 0.98
R2109:Tsen54 UTSW 11 115815723 missense probably damaging 1.00
R2248:Tsen54 UTSW 11 115815406 missense probably damaging 1.00
R2300:Tsen54 UTSW 11 115822078 missense probably damaging 1.00
R3081:Tsen54 UTSW 11 115820164 missense probably benign 0.08
R3763:Tsen54 UTSW 11 115820411 missense probably benign 0.22
R4179:Tsen54 UTSW 11 115820852 missense probably damaging 0.99
R4618:Tsen54 UTSW 11 115815421 unclassified probably benign
R5485:Tsen54 UTSW 11 115815222 missense probably benign 0.15
R6111:Tsen54 UTSW 11 115820130 missense possibly damaging 0.82
R6238:Tsen54 UTSW 11 115820687 missense probably benign 0.02
R6459:Tsen54 UTSW 11 115821680 missense probably damaging 1.00
R6555:Tsen54 UTSW 11 115820693 missense probably benign 0.43
R7378:Tsen54 UTSW 11 115821705 missense probably benign 0.19
R7520:Tsen54 UTSW 11 115820971 missense probably damaging 0.99
R7922:Tsen54 UTSW 11 115820782 nonsense probably null
R8110:Tsen54 UTSW 11 115814934 missense unknown
R8159:Tsen54 UTSW 11 115820978 nonsense probably null
X0028:Tsen54 UTSW 11 115817099 missense possibly damaging 0.50
Z1176:Tsen54 UTSW 11 115820578 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTAGCTTGAGGCCAATCTGATG -3'
(R):5'- CCACAAGATGACTATTGCGGTTC -3'

Sequencing Primer
(F):5'- ATGTGCATATCTCCAGGACG -3'
(R):5'- ACAAGATGACTATTGCGGTTCTTTGC -3'
Posted On2015-08-18