Incidental Mutation 'R4521:Ppwd1'
ID 334236
Institutional Source Beutler Lab
Gene Symbol Ppwd1
Ensembl Gene ENSMUSG00000021713
Gene Name peptidylprolyl isomerase domain and WD repeat containing 1
Synonyms 4632422M10Rik, A330090G21Rik
MMRRC Submission 041764-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.957) question?
Stock # R4521 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 104341632-104365351 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104346167 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 496 (V496A)
Ref Sequence ENSEMBL: ENSMUSP00000022226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022226]
AlphaFold Q8CEC6
Predicted Effect probably benign
Transcript: ENSMUST00000022226
AA Change: V496A

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022226
Gene: ENSMUSG00000021713
AA Change: V496A

DomainStartEndE-ValueType
WD40 80 117 2.96e-2 SMART
WD40 122 161 8.49e-3 SMART
Blast:WD40 164 207 9e-6 BLAST
WD40 211 251 2.76e0 SMART
WD40 269 308 1.4e-3 SMART
Blast:WD40 343 382 2e-6 BLAST
Blast:WD40 433 460 3e-7 BLAST
Pfam:Pro_isomerase 493 645 1.9e-52 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,536,766 (GRCm39) N700D probably benign Het
Bora G T 14: 99,305,984 (GRCm39) S451I probably damaging Het
Cadm3 A T 1: 173,172,630 (GRCm39) probably null Het
Car14 A G 3: 95,811,690 (GRCm39) probably benign Het
Ccdc88c G T 12: 100,879,591 (GRCm39) S1843R possibly damaging Het
Cdc20b A G 13: 113,217,725 (GRCm39) I381M probably damaging Het
Col12a1 C T 9: 79,540,639 (GRCm39) V2449I probably benign Het
Crb2 T C 2: 37,685,349 (GRCm39) probably benign Het
Dcaf6 A T 1: 165,218,059 (GRCm39) D347E probably damaging Het
Dlgap2 G A 8: 14,777,871 (GRCm39) R372H probably damaging Het
Fat3 T C 9: 15,834,238 (GRCm39) N4118S probably null Het
Fbxo41 A G 6: 85,461,024 (GRCm39) I228T probably damaging Het
Fpr2 A C 17: 18,113,509 (GRCm39) R168S probably benign Het
Ghr A G 15: 3,355,440 (GRCm39) I281T probably damaging Het
Glmp C A 3: 88,235,346 (GRCm39) N259K possibly damaging Het
Grhl3 T C 4: 135,273,561 (GRCm39) K564E probably damaging Het
Helz2 T C 2: 180,870,626 (GRCm39) H2875R probably benign Het
Lcp1 A G 14: 75,452,608 (GRCm39) D438G possibly damaging Het
Lrfn2 T A 17: 49,376,922 (GRCm39) M1K probably null Het
Lrp6 A G 6: 134,462,825 (GRCm39) C612R probably damaging Het
Map3k13 T C 16: 21,724,525 (GRCm39) V341A possibly damaging Het
Megf8 T A 7: 25,042,126 (GRCm39) C1315S probably benign Het
Mrgpra9 A T 7: 46,884,938 (GRCm39) L243H probably damaging Het
Mrgprx1 T C 7: 47,671,447 (GRCm39) D100G probably benign Het
Nop2 G T 6: 125,110,515 (GRCm39) R47L probably damaging Het
Nup93 T C 8: 95,041,264 (GRCm39) Y801H probably damaging Het
Or51b6b C T 7: 103,309,539 (GRCm39) R306H probably benign Het
Or6c69b T A 10: 129,627,050 (GRCm39) N136I possibly damaging Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Plce1 T C 19: 38,512,763 (GRCm39) S21P possibly damaging Het
Plpp2 A G 10: 79,366,459 (GRCm39) Y118H probably damaging Het
Rbm20 A G 19: 53,805,633 (GRCm39) N466S probably benign Het
Rpl10l T C 12: 66,330,512 (GRCm39) D207G probably benign Het
Skida1 T C 2: 18,050,683 (GRCm39) probably benign Het
Stk17b A G 1: 53,803,197 (GRCm39) Y73H probably damaging Het
Tapbpl A G 6: 125,205,085 (GRCm39) I287T probably damaging Het
Tmem38a C T 8: 73,326,005 (GRCm39) P20S possibly damaging Het
Topbp1 T C 9: 103,211,401 (GRCm39) probably benign Het
Tsen54 G A 11: 115,707,932 (GRCm39) probably null Het
Ttn G A 2: 76,555,560 (GRCm39) R28736* probably null Het
Wdr36 G A 18: 32,974,201 (GRCm39) probably null Het
Other mutations in Ppwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ppwd1 APN 13 104,353,651 (GRCm39) missense probably damaging 1.00
IGL01582:Ppwd1 APN 13 104,350,212 (GRCm39) missense probably benign 0.01
IGL01697:Ppwd1 APN 13 104,356,972 (GRCm39) missense probably benign 0.01
IGL01771:Ppwd1 APN 13 104,353,624 (GRCm39) missense probably damaging 1.00
IGL02414:Ppwd1 APN 13 104,359,645 (GRCm39) missense probably benign
IGL02803:Ppwd1 APN 13 104,350,192 (GRCm39) missense probably benign 0.00
IGL02873:Ppwd1 APN 13 104,346,261 (GRCm39) missense probably damaging 1.00
F5770:Ppwd1 UTSW 13 104,356,745 (GRCm39) missense probably damaging 0.98
R0462:Ppwd1 UTSW 13 104,359,468 (GRCm39) critical splice acceptor site probably null
R1638:Ppwd1 UTSW 13 104,356,771 (GRCm39) missense probably damaging 1.00
R2211:Ppwd1 UTSW 13 104,343,650 (GRCm39) missense probably benign 0.26
R2226:Ppwd1 UTSW 13 104,353,753 (GRCm39) missense probably damaging 1.00
R2299:Ppwd1 UTSW 13 104,356,571 (GRCm39) missense probably benign
R2353:Ppwd1 UTSW 13 104,350,090 (GRCm39) missense probably benign
R2382:Ppwd1 UTSW 13 104,343,621 (GRCm39) missense probably damaging 1.00
R3123:Ppwd1 UTSW 13 104,350,198 (GRCm39) missense possibly damaging 0.90
R4972:Ppwd1 UTSW 13 104,356,616 (GRCm39) missense probably benign 0.00
R5125:Ppwd1 UTSW 13 104,356,943 (GRCm39) missense probably benign 0.14
R5178:Ppwd1 UTSW 13 104,356,943 (GRCm39) missense probably benign 0.14
R5468:Ppwd1 UTSW 13 104,361,952 (GRCm39) missense possibly damaging 0.52
R5638:Ppwd1 UTSW 13 104,356,906 (GRCm39) missense probably damaging 1.00
R6748:Ppwd1 UTSW 13 104,344,538 (GRCm39) nonsense probably null
R7095:Ppwd1 UTSW 13 104,342,134 (GRCm39) missense probably benign 0.21
R7201:Ppwd1 UTSW 13 104,343,680 (GRCm39) missense probably damaging 1.00
R7206:Ppwd1 UTSW 13 104,350,106 (GRCm39) missense probably damaging 0.99
R7664:Ppwd1 UTSW 13 104,356,798 (GRCm39) missense probably damaging 1.00
R7746:Ppwd1 UTSW 13 104,353,714 (GRCm39) missense probably damaging 1.00
R9259:Ppwd1 UTSW 13 104,359,612 (GRCm39) missense probably damaging 1.00
R9354:Ppwd1 UTSW 13 104,342,080 (GRCm39) missense probably benign 0.00
R9408:Ppwd1 UTSW 13 104,346,155 (GRCm39) missense possibly damaging 0.74
V7580:Ppwd1 UTSW 13 104,356,745 (GRCm39) missense probably damaging 0.98
V7581:Ppwd1 UTSW 13 104,356,745 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCTCACAATAGGCTGCATTAAAAG -3'
(R):5'- GGTAAGTTGTTTAATTCAGCTGCTCAC -3'

Sequencing Primer
(F):5'- GGCTGCATTAAAAGTAATCTTTCTC -3'
(R):5'- GTTTAATTCAGCTGCTCACATTTTC -3'
Posted On 2015-08-18