Incidental Mutation 'R4521:Lcp1'
List |< first << previous [record 18 of 42] next >> last >|
ID334238
Institutional Source Beutler Lab
Gene Symbol Lcp1
Ensembl Gene ENSMUSG00000021998
Gene Namelymphocyte cytosolic protein 1
SynonymsD14Ertd310e, L-fimbrin, Pls2, L-plastin
MMRRC Submission 041764-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4521 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location75131101-75230842 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75215168 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 438 (D438G)
Ref Sequence ENSEMBL: ENSMUSP00000116271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124499] [ENSMUST00000131802] [ENSMUST00000145303]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124499
AA Change: D438G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998
AA Change: D438G

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131802
AA Change: D438G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998
AA Change: D438G

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000145303
AA Change: D438G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998
AA Change: D438G

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Meta Mutation Damage Score 0.2446 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Bora G T 14: 99,068,548 S451I probably damaging Het
Cadm3 A T 1: 173,345,063 probably null Het
Car14 A G 3: 95,904,378 probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdc20b A G 13: 113,081,191 I381M probably damaging Het
Col12a1 C T 9: 79,633,357 V2449I probably benign Het
Crb2 T C 2: 37,795,337 probably benign Het
Dcaf6 A T 1: 165,390,490 D347E probably damaging Het
Dlgap2 G A 8: 14,727,871 R372H probably damaging Het
Fat3 T C 9: 15,922,942 N4118S probably null Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fpr2 A C 17: 17,893,247 R168S probably benign Het
Ghr A G 15: 3,325,958 I281T probably damaging Het
Glmp C A 3: 88,328,039 N259K possibly damaging Het
Grhl3 T C 4: 135,546,250 K564E probably damaging Het
Helz2 T C 2: 181,228,833 H2875R probably benign Het
Lrfn2 T A 17: 49,069,894 M1K probably null Het
Lrp6 A G 6: 134,485,862 C612R probably damaging Het
Map3k13 T C 16: 21,905,775 V341A possibly damaging Het
Megf8 T A 7: 25,342,701 C1315S probably benign Het
Mrgpra9 A T 7: 47,235,190 L243H probably damaging Het
Mrgprx1 T C 7: 48,021,699 D100G probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nup93 T C 8: 94,314,636 Y801H probably damaging Het
Olfr623 C T 7: 103,660,332 R306H probably benign Het
Olfr810 T A 10: 129,791,181 N136I possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Plpp2 A G 10: 79,530,625 Y118H probably damaging Het
Ppwd1 A G 13: 104,209,659 V496A probably benign Het
Rbm20 A G 19: 53,817,202 N466S probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Skida1 T C 2: 18,045,872 probably benign Het
Stk17b A G 1: 53,764,038 Y73H probably damaging Het
Tapbpl A G 6: 125,228,122 I287T probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Topbp1 T C 9: 103,334,202 probably benign Het
Tsen54 G A 11: 115,817,106 probably null Het
Ttn G A 2: 76,725,216 R28736* probably null Het
Wdr36 G A 18: 32,841,148 probably null Het
Other mutations in Lcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Lcp1 APN 14 75227093 critical splice donor site probably null
IGL01768:Lcp1 APN 14 75224133 missense probably benign 0.40
IGL01801:Lcp1 APN 14 75199375 missense probably benign 0.10
IGL01940:Lcp1 APN 14 75216365 missense probably benign 0.17
IGL02135:Lcp1 APN 14 75200486 missense probably benign 0.00
IGL02185:Lcp1 APN 14 75229300 missense possibly damaging 0.73
IGL02478:Lcp1 APN 14 75224096 missense probably benign 0.04
IGL02604:Lcp1 APN 14 75224126 missense probably benign 0.11
R0244:Lcp1 UTSW 14 75227001 missense possibly damaging 0.92
R0295:Lcp1 UTSW 14 75199420 missense probably null 0.59
R0313:Lcp1 UTSW 14 75199433 missense probably damaging 1.00
R0415:Lcp1 UTSW 14 75227006 missense possibly damaging 0.88
R0751:Lcp1 UTSW 14 75199387 missense probably benign 0.00
R0811:Lcp1 UTSW 14 75214488 missense probably benign 0.00
R0812:Lcp1 UTSW 14 75214488 missense probably benign 0.00
R1200:Lcp1 UTSW 14 75229302 missense possibly damaging 0.73
R1713:Lcp1 UTSW 14 75199444 critical splice donor site probably null
R1915:Lcp1 UTSW 14 75199297 missense possibly damaging 0.81
R1969:Lcp1 UTSW 14 75200506 missense probably damaging 1.00
R1970:Lcp1 UTSW 14 75200506 missense probably damaging 1.00
R1971:Lcp1 UTSW 14 75200506 missense probably damaging 1.00
R2045:Lcp1 UTSW 14 75200401 missense probably benign 0.01
R2064:Lcp1 UTSW 14 75198075 critical splice acceptor site probably null
R3949:Lcp1 UTSW 14 75206129 missense possibly damaging 0.68
R4062:Lcp1 UTSW 14 75215180 missense probably damaging 1.00
R4811:Lcp1 UTSW 14 75200408 missense probably damaging 0.99
R4854:Lcp1 UTSW 14 75200489 missense probably damaging 1.00
R4974:Lcp1 UTSW 14 75208471 nonsense probably null
R5539:Lcp1 UTSW 14 75229298 missense probably benign 0.08
R5561:Lcp1 UTSW 14 75212508 missense probably benign 0.01
R5724:Lcp1 UTSW 14 75226982 missense probably benign 0.18
R5989:Lcp1 UTSW 14 75199387 missense probably benign 0.00
R6731:Lcp1 UTSW 14 75206189 missense probably damaging 1.00
R7346:Lcp1 UTSW 14 75210506 missense possibly damaging 0.49
R7670:Lcp1 UTSW 14 75200431 missense probably benign 0.12
R7698:Lcp1 UTSW 14 75206211 nonsense probably null
S24628:Lcp1 UTSW 14 75227006 missense possibly damaging 0.88
X0027:Lcp1 UTSW 14 75227086 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCTACCAAGTTTCTAGGGTTC -3'
(R):5'- TCCACTGCAATGACAGGTTCAG -3'

Sequencing Primer
(F):5'- TTCCTAGGGACGTTGCAGGAAC -3'
(R):5'- ATGGAAGTCTTCATAAGGTCTCTGTC -3'
Posted On2015-08-18