Incidental Mutation 'R4521:Bora'
ID334239
Institutional Source Beutler Lab
Gene Symbol Bora
Ensembl Gene ENSMUSG00000022070
Gene Namebora, aurora kinase A activator
Synonyms6720463M24Rik
MMRRC Submission 041764-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R4521 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location99046222-99074540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 99068548 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 451 (S451I)
Ref Sequence ENSEMBL: ENSMUSP00000022656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022656] [ENSMUST00000227744]
Predicted Effect probably damaging
Transcript: ENSMUST00000022656
AA Change: S451I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022656
Gene: ENSMUSG00000022070
AA Change: S451I

DomainStartEndE-ValueType
Pfam:BORA_N 7 207 2.4e-69 PFAM
low complexity region 392 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227744
Meta Mutation Damage Score 0.2115 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BORA is an activator of the protein kinase Aurora A (AURKA; MIM 603072), which is required for centrosome maturation, spindle assembly, and asymmetric protein localization during mitosis (Hutterer et al., 2006 [PubMed 16890155]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Cadm3 A T 1: 173,345,063 probably null Het
Car14 A G 3: 95,904,378 probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdc20b A G 13: 113,081,191 I381M probably damaging Het
Col12a1 C T 9: 79,633,357 V2449I probably benign Het
Crb2 T C 2: 37,795,337 probably benign Het
Dcaf6 A T 1: 165,390,490 D347E probably damaging Het
Dlgap2 G A 8: 14,727,871 R372H probably damaging Het
Fat3 T C 9: 15,922,942 N4118S probably null Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fpr2 A C 17: 17,893,247 R168S probably benign Het
Ghr A G 15: 3,325,958 I281T probably damaging Het
Glmp C A 3: 88,328,039 N259K possibly damaging Het
Grhl3 T C 4: 135,546,250 K564E probably damaging Het
Helz2 T C 2: 181,228,833 H2875R probably benign Het
Lcp1 A G 14: 75,215,168 D438G possibly damaging Het
Lrfn2 T A 17: 49,069,894 M1K probably null Het
Lrp6 A G 6: 134,485,862 C612R probably damaging Het
Map3k13 T C 16: 21,905,775 V341A possibly damaging Het
Megf8 T A 7: 25,342,701 C1315S probably benign Het
Mrgpra9 A T 7: 47,235,190 L243H probably damaging Het
Mrgprx1 T C 7: 48,021,699 D100G probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nup93 T C 8: 94,314,636 Y801H probably damaging Het
Olfr623 C T 7: 103,660,332 R306H probably benign Het
Olfr810 T A 10: 129,791,181 N136I possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Plpp2 A G 10: 79,530,625 Y118H probably damaging Het
Ppwd1 A G 13: 104,209,659 V496A probably benign Het
Rbm20 A G 19: 53,817,202 N466S probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Skida1 T C 2: 18,045,872 probably benign Het
Stk17b A G 1: 53,764,038 Y73H probably damaging Het
Tapbpl A G 6: 125,228,122 I287T probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Topbp1 T C 9: 103,334,202 probably benign Het
Tsen54 G A 11: 115,817,106 probably null Het
Ttn G A 2: 76,725,216 R28736* probably null Het
Wdr36 G A 18: 32,841,148 probably null Het
Other mutations in Bora
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Bora APN 14 99047377 missense probably damaging 1.00
IGL02119:Bora APN 14 99053538 missense probably damaging 1.00
IGL02129:Bora APN 14 99056821 critical splice donor site probably null
IGL02171:Bora APN 14 99047322 missense probably damaging 1.00
IGL03338:Bora APN 14 99072742 missense probably damaging 1.00
R0504:Bora UTSW 14 99061623 nonsense probably null
R1598:Bora UTSW 14 99068404 missense probably benign
R2070:Bora UTSW 14 99062278 missense probably damaging 1.00
R2071:Bora UTSW 14 99062278 missense probably damaging 1.00
R4861:Bora UTSW 14 99047474 splice site probably null
R4881:Bora UTSW 14 99061567 missense probably damaging 1.00
R4982:Bora UTSW 14 99047352 missense probably damaging 1.00
R5341:Bora UTSW 14 99068094 missense probably damaging 1.00
R5378:Bora UTSW 14 99068493 missense probably damaging 1.00
R5913:Bora UTSW 14 99068512 missense probably benign 0.02
R6082:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6083:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6084:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6085:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6086:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6269:Bora UTSW 14 99073667 missense probably damaging 0.99
R7354:Bora UTSW 14 99047358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGATATGGTCGATCCTACAG -3'
(R):5'- AAAAGACAGGTTTGCACAGTTG -3'

Sequencing Primer
(F):5'- TATGGTCGATCCTACAGACACAGTAG -3'
(R):5'- GGCTTTGAGTTCACAACGATC -3'
Posted On2015-08-18