Incidental Mutation 'R4521:Map3k13'
ID 334241
Institutional Source Beutler Lab
Gene Symbol Map3k13
Ensembl Gene ENSMUSG00000033618
Gene Name mitogen-activated protein kinase kinase kinase 13
Synonyms C130026N12Rik
MMRRC Submission 041764-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4521 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 21643923-21752189 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21724525 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 341 (V341A)
Ref Sequence ENSEMBL: ENSMUSP00000156202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042065] [ENSMUST00000231988] [ENSMUST00000232240]
AlphaFold Q1HKZ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000042065
AA Change: V341A

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618
AA Change: V341A

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
Pfam:Pkinase 167 406 3.1e-60 PFAM
Pfam:Pkinase_Tyr 167 406 2.4e-65 PFAM
coiled coil region 456 502 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
low complexity region 805 821 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180401
Predicted Effect possibly damaging
Transcript: ENSMUST00000231988
AA Change: V341A

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232240
AA Change: V341A

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.4000 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,536,766 (GRCm39) N700D probably benign Het
Bora G T 14: 99,305,984 (GRCm39) S451I probably damaging Het
Cadm3 A T 1: 173,172,630 (GRCm39) probably null Het
Car14 A G 3: 95,811,690 (GRCm39) probably benign Het
Ccdc88c G T 12: 100,879,591 (GRCm39) S1843R possibly damaging Het
Cdc20b A G 13: 113,217,725 (GRCm39) I381M probably damaging Het
Col12a1 C T 9: 79,540,639 (GRCm39) V2449I probably benign Het
Crb2 T C 2: 37,685,349 (GRCm39) probably benign Het
Dcaf6 A T 1: 165,218,059 (GRCm39) D347E probably damaging Het
Dlgap2 G A 8: 14,777,871 (GRCm39) R372H probably damaging Het
Fat3 T C 9: 15,834,238 (GRCm39) N4118S probably null Het
Fbxo41 A G 6: 85,461,024 (GRCm39) I228T probably damaging Het
Fpr2 A C 17: 18,113,509 (GRCm39) R168S probably benign Het
Ghr A G 15: 3,355,440 (GRCm39) I281T probably damaging Het
Glmp C A 3: 88,235,346 (GRCm39) N259K possibly damaging Het
Grhl3 T C 4: 135,273,561 (GRCm39) K564E probably damaging Het
Helz2 T C 2: 180,870,626 (GRCm39) H2875R probably benign Het
Lcp1 A G 14: 75,452,608 (GRCm39) D438G possibly damaging Het
Lrfn2 T A 17: 49,376,922 (GRCm39) M1K probably null Het
Lrp6 A G 6: 134,462,825 (GRCm39) C612R probably damaging Het
Megf8 T A 7: 25,042,126 (GRCm39) C1315S probably benign Het
Mrgpra9 A T 7: 46,884,938 (GRCm39) L243H probably damaging Het
Mrgprx1 T C 7: 47,671,447 (GRCm39) D100G probably benign Het
Nop2 G T 6: 125,110,515 (GRCm39) R47L probably damaging Het
Nup93 T C 8: 95,041,264 (GRCm39) Y801H probably damaging Het
Or51b6b C T 7: 103,309,539 (GRCm39) R306H probably benign Het
Or6c69b T A 10: 129,627,050 (GRCm39) N136I possibly damaging Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Plce1 T C 19: 38,512,763 (GRCm39) S21P possibly damaging Het
Plpp2 A G 10: 79,366,459 (GRCm39) Y118H probably damaging Het
Ppwd1 A G 13: 104,346,167 (GRCm39) V496A probably benign Het
Rbm20 A G 19: 53,805,633 (GRCm39) N466S probably benign Het
Rpl10l T C 12: 66,330,512 (GRCm39) D207G probably benign Het
Skida1 T C 2: 18,050,683 (GRCm39) probably benign Het
Stk17b A G 1: 53,803,197 (GRCm39) Y73H probably damaging Het
Tapbpl A G 6: 125,205,085 (GRCm39) I287T probably damaging Het
Tmem38a C T 8: 73,326,005 (GRCm39) P20S possibly damaging Het
Topbp1 T C 9: 103,211,401 (GRCm39) probably benign Het
Tsen54 G A 11: 115,707,932 (GRCm39) probably null Het
Ttn G A 2: 76,555,560 (GRCm39) R28736* probably null Het
Wdr36 G A 18: 32,974,201 (GRCm39) probably null Het
Other mutations in Map3k13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Map3k13 APN 16 21,740,514 (GRCm39) missense probably benign 0.00
IGL01092:Map3k13 APN 16 21,746,766 (GRCm39) missense probably damaging 0.97
IGL01958:Map3k13 APN 16 21,710,873 (GRCm39) missense probably benign
IGL02444:Map3k13 APN 16 21,732,982 (GRCm39) missense probably benign 0.19
IGL02503:Map3k13 APN 16 21,727,454 (GRCm39) missense possibly damaging 0.50
IGL02712:Map3k13 APN 16 21,724,005 (GRCm39) missense probably damaging 0.99
IGL03342:Map3k13 APN 16 21,710,981 (GRCm39) missense possibly damaging 0.94
R0086:Map3k13 UTSW 16 21,732,975 (GRCm39) missense probably damaging 0.98
R0124:Map3k13 UTSW 16 21,722,506 (GRCm39) missense possibly damaging 0.95
R0281:Map3k13 UTSW 16 21,732,907 (GRCm39) missense probably damaging 1.00
R0308:Map3k13 UTSW 16 21,710,738 (GRCm39) missense probably benign
R0601:Map3k13 UTSW 16 21,723,999 (GRCm39) missense possibly damaging 0.95
R0669:Map3k13 UTSW 16 21,725,274 (GRCm39) missense probably benign 0.03
R0918:Map3k13 UTSW 16 21,744,990 (GRCm39) missense probably damaging 1.00
R1641:Map3k13 UTSW 16 21,722,542 (GRCm39) missense probably damaging 1.00
R1838:Map3k13 UTSW 16 21,732,939 (GRCm39) missense possibly damaging 0.92
R1891:Map3k13 UTSW 16 21,729,836 (GRCm39) missense probably damaging 1.00
R2125:Map3k13 UTSW 16 21,710,894 (GRCm39) missense probably benign 0.01
R2332:Map3k13 UTSW 16 21,717,427 (GRCm39) splice site probably null
R2361:Map3k13 UTSW 16 21,725,286 (GRCm39) missense probably benign 0.05
R4395:Map3k13 UTSW 16 21,717,321 (GRCm39) missense possibly damaging 0.49
R4505:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4506:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4753:Map3k13 UTSW 16 21,710,752 (GRCm39) missense probably benign
R4952:Map3k13 UTSW 16 21,729,769 (GRCm39) missense probably benign 0.15
R5035:Map3k13 UTSW 16 21,740,421 (GRCm39) missense probably benign 0.03
R5327:Map3k13 UTSW 16 21,740,397 (GRCm39) missense possibly damaging 0.89
R5784:Map3k13 UTSW 16 21,717,391 (GRCm39) missense possibly damaging 0.68
R5831:Map3k13 UTSW 16 21,746,798 (GRCm39) makesense probably null
R5996:Map3k13 UTSW 16 21,723,995 (GRCm39) missense possibly damaging 0.95
R6007:Map3k13 UTSW 16 21,723,933 (GRCm39) missense possibly damaging 0.95
R6546:Map3k13 UTSW 16 21,740,527 (GRCm39) missense probably benign 0.15
R6620:Map3k13 UTSW 16 21,711,061 (GRCm39) missense possibly damaging 0.62
R6683:Map3k13 UTSW 16 21,711,062 (GRCm39) missense probably benign 0.32
R6692:Map3k13 UTSW 16 21,723,987 (GRCm39) missense possibly damaging 0.66
R6695:Map3k13 UTSW 16 21,741,028 (GRCm39) missense probably benign 0.10
R6743:Map3k13 UTSW 16 21,711,173 (GRCm39) missense probably damaging 0.98
R6822:Map3k13 UTSW 16 21,741,013 (GRCm39) missense probably benign 0.00
R6965:Map3k13 UTSW 16 21,740,900 (GRCm39) missense probably benign
R7149:Map3k13 UTSW 16 21,744,187 (GRCm39) missense probably benign 0.04
R7174:Map3k13 UTSW 16 21,745,006 (GRCm39) missense probably damaging 1.00
R7256:Map3k13 UTSW 16 21,710,988 (GRCm39) missense probably benign 0.03
R7400:Map3k13 UTSW 16 21,741,072 (GRCm39) missense probably damaging 1.00
R7733:Map3k13 UTSW 16 21,740,436 (GRCm39) missense probably damaging 1.00
R7848:Map3k13 UTSW 16 21,724,621 (GRCm39) missense probably damaging 0.98
R7871:Map3k13 UTSW 16 21,740,346 (GRCm39) missense probably benign 0.09
R7876:Map3k13 UTSW 16 21,741,069 (GRCm39) missense probably benign 0.00
R8002:Map3k13 UTSW 16 21,723,878 (GRCm39) missense probably benign 0.05
R8089:Map3k13 UTSW 16 21,722,567 (GRCm39) missense possibly damaging 0.48
R8341:Map3k13 UTSW 16 21,740,334 (GRCm39) nonsense probably null
R8738:Map3k13 UTSW 16 21,745,008 (GRCm39) missense probably damaging 1.00
R8940:Map3k13 UTSW 16 21,727,454 (GRCm39) missense possibly damaging 0.50
R8949:Map3k13 UTSW 16 21,723,882 (GRCm39) missense probably benign 0.05
R9391:Map3k13 UTSW 16 21,740,665 (GRCm39) missense probably benign 0.00
R9749:Map3k13 UTSW 16 21,740,581 (GRCm39) missense probably benign 0.00
R9802:Map3k13 UTSW 16 21,740,518 (GRCm39) missense possibly damaging 0.85
Z1176:Map3k13 UTSW 16 21,723,912 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAAGGCCTTATAAAATGCATAGC -3'
(R):5'- TCCTTCCAAGCACCCTGTAG -3'

Sequencing Primer
(F):5'- TCAGCATGGCCTGAAACCTG -3'
(R):5'- TTCCAAGCACCCTGTAGAGGTG -3'
Posted On 2015-08-18