Incidental Mutation 'R4521:Fpr2'
ID334242
Institutional Source Beutler Lab
Gene Symbol Fpr2
Ensembl Gene ENSMUSG00000052270
Gene Nameformyl peptide receptor 2
SynonymsE330010I07Rik, Fpr-rs2
MMRRC Submission 041764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4521 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location17887824-17893952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 17893247 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 168 (R168S)
Ref Sequence ENSEMBL: ENSMUSP00000065799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054871] [ENSMUST00000064068] [ENSMUST00000149944]
Predicted Effect probably benign
Transcript: ENSMUST00000054871
SMART Domains Protein: ENSMUSP00000093316
Gene: ENSMUSG00000079700

DomainStartEndE-ValueType
Pfam:7tm_1 43 302 2.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064068
AA Change: R168S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000065799
Gene: ENSMUSG00000052270
AA Change: R168S

DomainStartEndE-ValueType
Pfam:7tm_1 43 302 4.3e-36 PFAM
low complexity region 326 341 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000149944
AA Change: N31H
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted reporter allele exhibit altered leukocyte responses and experimentally induced inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Bora G T 14: 99,068,548 S451I probably damaging Het
Cadm3 A T 1: 173,345,063 probably null Het
Car14 A G 3: 95,904,378 probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdc20b A G 13: 113,081,191 I381M probably damaging Het
Col12a1 C T 9: 79,633,357 V2449I probably benign Het
Crb2 T C 2: 37,795,337 probably benign Het
Dcaf6 A T 1: 165,390,490 D347E probably damaging Het
Dlgap2 G A 8: 14,727,871 R372H probably damaging Het
Fat3 T C 9: 15,922,942 N4118S probably null Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Ghr A G 15: 3,325,958 I281T probably damaging Het
Glmp C A 3: 88,328,039 N259K possibly damaging Het
Grhl3 T C 4: 135,546,250 K564E probably damaging Het
Helz2 T C 2: 181,228,833 H2875R probably benign Het
Lcp1 A G 14: 75,215,168 D438G possibly damaging Het
Lrfn2 T A 17: 49,069,894 M1K probably null Het
Lrp6 A G 6: 134,485,862 C612R probably damaging Het
Map3k13 T C 16: 21,905,775 V341A possibly damaging Het
Megf8 T A 7: 25,342,701 C1315S probably benign Het
Mrgpra9 A T 7: 47,235,190 L243H probably damaging Het
Mrgprx1 T C 7: 48,021,699 D100G probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nup93 T C 8: 94,314,636 Y801H probably damaging Het
Olfr623 C T 7: 103,660,332 R306H probably benign Het
Olfr810 T A 10: 129,791,181 N136I possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Plpp2 A G 10: 79,530,625 Y118H probably damaging Het
Ppwd1 A G 13: 104,209,659 V496A probably benign Het
Rbm20 A G 19: 53,817,202 N466S probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Skida1 T C 2: 18,045,872 probably benign Het
Stk17b A G 1: 53,764,038 Y73H probably damaging Het
Tapbpl A G 6: 125,228,122 I287T probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Topbp1 T C 9: 103,334,202 probably benign Het
Tsen54 G A 11: 115,817,106 probably null Het
Ttn G A 2: 76,725,216 R28736* probably null Het
Wdr36 G A 18: 32,841,148 probably null Het
Other mutations in Fpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Fpr2 APN 17 17892772 missense probably damaging 0.98
IGL01481:Fpr2 APN 17 17892763 missense probably benign 0.01
IGL02320:Fpr2 APN 17 17893346 missense probably benign 0.05
IGL02479:Fpr2 APN 17 17892812 missense probably benign 0.01
R1553:Fpr2 UTSW 17 17893594 missense possibly damaging 0.87
R3906:Fpr2 UTSW 17 17893549 missense probably benign 0.03
R4424:Fpr2 UTSW 17 17893132 missense probably damaging 1.00
R4480:Fpr2 UTSW 17 17893753 missense probably benign 0.01
R4718:Fpr2 UTSW 17 17893336 missense probably benign 0.00
R5385:Fpr2 UTSW 17 17893047 missense probably benign 0.00
R7184:Fpr2 UTSW 17 17893271 missense unknown
R7233:Fpr2 UTSW 17 17893504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCTGTTTGGAAGTGTCTTCTTG -3'
(R):5'- CACAACTGCTGTAAGGACTCG -3'

Sequencing Primer
(F):5'- GATTGCTCTCATTGCCTTGGAC -3'
(R):5'- CTGTTGATCTTGACAGCAATGAGTCC -3'
Posted On2015-08-18