Incidental Mutation 'R4521:Lrfn2'
ID 334243
Institutional Source Beutler Lab
Gene Symbol Lrfn2
Ensembl Gene ENSMUSG00000040490
Gene Name leucine rich repeat and fibronectin type III domain containing 2
Synonyms 5730420O05Rik, SALM1
MMRRC Submission 041764-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4521 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 49239407-49404616 bp(+) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) T to A at 49376922 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000047573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046254]
AlphaFold Q80TG9
Predicted Effect probably null
Transcript: ENSMUST00000046254
AA Change: M1K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000047573
Gene: ENSMUSG00000040490
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
LRRNT 20 56 2.9e0 SMART
LRR 75 98 7.36e0 SMART
LRR_TYP 99 122 1.1e-2 SMART
LRR_TYP 123 146 2.2e-2 SMART
LRR 148 171 4.45e1 SMART
LRR_TYP 172 195 1.56e-2 SMART
LRR 196 220 1.06e1 SMART
LRRCT 242 287 5.53e-4 SMART
IGc2 301 366 8e-12 SMART
low complexity region 401 415 N/A INTRINSIC
FN3 420 500 1.52e-1 SMART
transmembrane domain 533 555 N/A INTRINSIC
low complexity region 613 654 N/A INTRINSIC
Meta Mutation Damage Score 0.9246 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit small spleens, small or no thymi, impaired T cell development, and decreased T cell proliferation in response to mitogen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,536,766 (GRCm39) N700D probably benign Het
Bora G T 14: 99,305,984 (GRCm39) S451I probably damaging Het
Cadm3 A T 1: 173,172,630 (GRCm39) probably null Het
Car14 A G 3: 95,811,690 (GRCm39) probably benign Het
Ccdc88c G T 12: 100,879,591 (GRCm39) S1843R possibly damaging Het
Cdc20b A G 13: 113,217,725 (GRCm39) I381M probably damaging Het
Col12a1 C T 9: 79,540,639 (GRCm39) V2449I probably benign Het
Crb2 T C 2: 37,685,349 (GRCm39) probably benign Het
Dcaf6 A T 1: 165,218,059 (GRCm39) D347E probably damaging Het
Dlgap2 G A 8: 14,777,871 (GRCm39) R372H probably damaging Het
Fat3 T C 9: 15,834,238 (GRCm39) N4118S probably null Het
Fbxo41 A G 6: 85,461,024 (GRCm39) I228T probably damaging Het
Fpr2 A C 17: 18,113,509 (GRCm39) R168S probably benign Het
Ghr A G 15: 3,355,440 (GRCm39) I281T probably damaging Het
Glmp C A 3: 88,235,346 (GRCm39) N259K possibly damaging Het
Grhl3 T C 4: 135,273,561 (GRCm39) K564E probably damaging Het
Helz2 T C 2: 180,870,626 (GRCm39) H2875R probably benign Het
Lcp1 A G 14: 75,452,608 (GRCm39) D438G possibly damaging Het
Lrp6 A G 6: 134,462,825 (GRCm39) C612R probably damaging Het
Map3k13 T C 16: 21,724,525 (GRCm39) V341A possibly damaging Het
Megf8 T A 7: 25,042,126 (GRCm39) C1315S probably benign Het
Mrgpra9 A T 7: 46,884,938 (GRCm39) L243H probably damaging Het
Mrgprx1 T C 7: 47,671,447 (GRCm39) D100G probably benign Het
Nop2 G T 6: 125,110,515 (GRCm39) R47L probably damaging Het
Nup93 T C 8: 95,041,264 (GRCm39) Y801H probably damaging Het
Or51b6b C T 7: 103,309,539 (GRCm39) R306H probably benign Het
Or6c69b T A 10: 129,627,050 (GRCm39) N136I possibly damaging Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Plce1 T C 19: 38,512,763 (GRCm39) S21P possibly damaging Het
Plpp2 A G 10: 79,366,459 (GRCm39) Y118H probably damaging Het
Ppwd1 A G 13: 104,346,167 (GRCm39) V496A probably benign Het
Rbm20 A G 19: 53,805,633 (GRCm39) N466S probably benign Het
Rpl10l T C 12: 66,330,512 (GRCm39) D207G probably benign Het
Skida1 T C 2: 18,050,683 (GRCm39) probably benign Het
Stk17b A G 1: 53,803,197 (GRCm39) Y73H probably damaging Het
Tapbpl A G 6: 125,205,085 (GRCm39) I287T probably damaging Het
Tmem38a C T 8: 73,326,005 (GRCm39) P20S possibly damaging Het
Topbp1 T C 9: 103,211,401 (GRCm39) probably benign Het
Tsen54 G A 11: 115,707,932 (GRCm39) probably null Het
Ttn G A 2: 76,555,560 (GRCm39) R28736* probably null Het
Wdr36 G A 18: 32,974,201 (GRCm39) probably null Het
Other mutations in Lrfn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Lrfn2 APN 17 49,377,425 (GRCm39) missense possibly damaging 0.81
IGL01989:Lrfn2 APN 17 49,378,113 (GRCm39) missense probably damaging 1.00
IGL03324:Lrfn2 APN 17 49,377,915 (GRCm39) missense probably damaging 1.00
IGL02991:Lrfn2 UTSW 17 49,377,732 (GRCm39) missense probably damaging 1.00
R0306:Lrfn2 UTSW 17 49,403,283 (GRCm39) missense probably damaging 0.99
R0539:Lrfn2 UTSW 17 49,378,072 (GRCm39) missense probably damaging 1.00
R1245:Lrfn2 UTSW 17 49,403,277 (GRCm39) critical splice acceptor site probably null
R1414:Lrfn2 UTSW 17 49,377,857 (GRCm39) missense probably benign 0.01
R1437:Lrfn2 UTSW 17 49,378,253 (GRCm39) missense probably damaging 0.97
R1670:Lrfn2 UTSW 17 49,403,605 (GRCm39) missense probably benign 0.01
R2358:Lrfn2 UTSW 17 49,378,188 (GRCm39) missense possibly damaging 0.92
R3711:Lrfn2 UTSW 17 49,378,188 (GRCm39) missense possibly damaging 0.92
R3712:Lrfn2 UTSW 17 49,378,188 (GRCm39) missense possibly damaging 0.92
R4532:Lrfn2 UTSW 17 49,377,564 (GRCm39) missense probably damaging 1.00
R4724:Lrfn2 UTSW 17 49,377,462 (GRCm39) missense probably damaging 1.00
R5062:Lrfn2 UTSW 17 49,377,528 (GRCm39) missense probably damaging 1.00
R5066:Lrfn2 UTSW 17 49,403,448 (GRCm39) missense probably damaging 1.00
R5348:Lrfn2 UTSW 17 49,403,718 (GRCm39) missense probably benign
R5673:Lrfn2 UTSW 17 49,403,625 (GRCm39) missense probably benign 0.02
R5900:Lrfn2 UTSW 17 49,377,291 (GRCm39) missense possibly damaging 0.82
R6014:Lrfn2 UTSW 17 49,376,934 (GRCm39) missense possibly damaging 0.96
R6087:Lrfn2 UTSW 17 49,378,154 (GRCm39) missense probably benign
R6224:Lrfn2 UTSW 17 49,403,379 (GRCm39) missense probably damaging 1.00
R6229:Lrfn2 UTSW 17 49,404,160 (GRCm39) missense possibly damaging 0.88
R6342:Lrfn2 UTSW 17 49,404,028 (GRCm39) missense probably benign 0.27
R6408:Lrfn2 UTSW 17 49,377,654 (GRCm39) missense probably damaging 1.00
R7026:Lrfn2 UTSW 17 49,404,005 (GRCm39) missense probably benign 0.00
R7505:Lrfn2 UTSW 17 49,403,479 (GRCm39) missense probably benign 0.14
R7852:Lrfn2 UTSW 17 49,376,972 (GRCm39) missense possibly damaging 0.69
R7918:Lrfn2 UTSW 17 49,378,212 (GRCm39) missense probably damaging 0.99
R8375:Lrfn2 UTSW 17 49,403,851 (GRCm39) missense possibly damaging 0.73
R8733:Lrfn2 UTSW 17 49,403,824 (GRCm39) missense probably damaging 0.96
R8828:Lrfn2 UTSW 17 49,404,132 (GRCm39) missense probably damaging 1.00
R8872:Lrfn2 UTSW 17 49,378,277 (GRCm39) nonsense probably null
R8892:Lrfn2 UTSW 17 49,377,376 (GRCm39) missense probably damaging 1.00
R9135:Lrfn2 UTSW 17 49,376,976 (GRCm39) missense possibly damaging 0.95
R9358:Lrfn2 UTSW 17 49,403,530 (GRCm39) missense probably damaging 0.99
R9661:Lrfn2 UTSW 17 49,403,650 (GRCm39) missense probably benign
Z1177:Lrfn2 UTSW 17 49,403,743 (GRCm39) missense probably damaging 0.99
Z1177:Lrfn2 UTSW 17 49,377,123 (GRCm39) missense probably benign 0.03
Z1177:Lrfn2 UTSW 17 49,377,040 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTTGTTAGGAGATAAGACCAGCTG -3'
(R):5'- CAAAGTCTTGGCGGCCAATG -3'

Sequencing Primer
(F):5'- TTAGGAGATAAGACCAGCTGAGGAG -3'
(R):5'- TGGATGATGAAGTTGCCACCC -3'
Posted On 2015-08-18