Incidental Mutation 'R4521:Wdr36'
List |< first << previous [record 42 of 42]
ID334244
Institutional Source Beutler Lab
Gene Symbol Wdr36
Ensembl Gene ENSMUSG00000038299
Gene NameWD repeat domain 36
Synonyms5730444A13Rik
MMRRC Submission 041764-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4521 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location32837225-32866420 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 32841148 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053663] [ENSMUST00000166214]
Predicted Effect probably null
Transcript: ENSMUST00000053663
SMART Domains Protein: ENSMUSP00000052465
Gene: ENSMUSG00000038299

DomainStartEndE-ValueType
WD40 98 135 3.21e-1 SMART
Blast:WD40 140 180 3e-15 BLAST
WD40 183 222 9.21e0 SMART
WD40 226 265 1.43e0 SMART
WD40 268 308 5.35e-1 SMART
WD40 315 355 7.43e-1 SMART
WD40 473 515 1.46e-1 SMART
WD40 559 598 2.2e-10 SMART
WD40 601 640 1.43e1 SMART
Pfam:Utp21 673 895 9.7e-72 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166214
SMART Domains Protein: ENSMUSP00000132189
Gene: ENSMUSG00000038299

DomainStartEndE-ValueType
WD40 98 135 3.21e-1 SMART
Blast:WD40 140 180 3e-15 BLAST
WD40 183 222 9.21e0 SMART
WD40 226 265 1.43e0 SMART
WD40 268 308 5.35e-1 SMART
WD40 315 355 7.43e-1 SMART
WD40 473 515 1.46e-1 SMART
WD40 559 598 2.2e-10 SMART
WD40 601 640 1.43e1 SMART
Pfam:Utp21 668 883 6.1e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181632
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Mutations in this gene have been associated with adult-onset primary open-angle glaucoma (POAG). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality before implantation. In culture, homozygous mutant embryos fail to reach the blastocyst stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Bora G T 14: 99,068,548 S451I probably damaging Het
Cadm3 A T 1: 173,345,063 probably null Het
Car14 A G 3: 95,904,378 probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdc20b A G 13: 113,081,191 I381M probably damaging Het
Col12a1 C T 9: 79,633,357 V2449I probably benign Het
Crb2 T C 2: 37,795,337 probably benign Het
Dcaf6 A T 1: 165,390,490 D347E probably damaging Het
Dlgap2 G A 8: 14,727,871 R372H probably damaging Het
Fat3 T C 9: 15,922,942 N4118S probably null Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fpr2 A C 17: 17,893,247 R168S probably benign Het
Ghr A G 15: 3,325,958 I281T probably damaging Het
Glmp C A 3: 88,328,039 N259K possibly damaging Het
Grhl3 T C 4: 135,546,250 K564E probably damaging Het
Helz2 T C 2: 181,228,833 H2875R probably benign Het
Lcp1 A G 14: 75,215,168 D438G possibly damaging Het
Lrfn2 T A 17: 49,069,894 M1K probably null Het
Lrp6 A G 6: 134,485,862 C612R probably damaging Het
Map3k13 T C 16: 21,905,775 V341A possibly damaging Het
Megf8 T A 7: 25,342,701 C1315S probably benign Het
Mrgpra9 A T 7: 47,235,190 L243H probably damaging Het
Mrgprx1 T C 7: 48,021,699 D100G probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nup93 T C 8: 94,314,636 Y801H probably damaging Het
Olfr623 C T 7: 103,660,332 R306H probably benign Het
Olfr810 T A 10: 129,791,181 N136I possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Plpp2 A G 10: 79,530,625 Y118H probably damaging Het
Ppwd1 A G 13: 104,209,659 V496A probably benign Het
Rbm20 A G 19: 53,817,202 N466S probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Skida1 T C 2: 18,045,872 probably benign Het
Stk17b A G 1: 53,764,038 Y73H probably damaging Het
Tapbpl A G 6: 125,228,122 I287T probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Topbp1 T C 9: 103,334,202 probably benign Het
Tsen54 G A 11: 115,817,106 probably null Het
Ttn G A 2: 76,725,216 R28736* probably null Het
Other mutations in Wdr36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Wdr36 APN 18 32845631 missense possibly damaging 0.86
IGL01975:Wdr36 APN 18 32852488 missense probably damaging 1.00
IGL02001:Wdr36 APN 18 32852888 missense probably damaging 1.00
IGL02605:Wdr36 APN 18 32851991 missense possibly damaging 0.94
IGL02625:Wdr36 APN 18 32859261 missense possibly damaging 0.51
IGL02928:Wdr36 APN 18 32847319 critical splice donor site probably null
R0025:Wdr36 UTSW 18 32859307 missense probably damaging 1.00
R0025:Wdr36 UTSW 18 32859307 missense probably damaging 1.00
R0062:Wdr36 UTSW 18 32864749 missense possibly damaging 0.90
R0062:Wdr36 UTSW 18 32864749 missense possibly damaging 0.90
R0331:Wdr36 UTSW 18 32852915 missense possibly damaging 0.83
R0626:Wdr36 UTSW 18 32850531 missense probably damaging 1.00
R0835:Wdr36 UTSW 18 32849082 missense possibly damaging 0.87
R1484:Wdr36 UTSW 18 32843885 missense possibly damaging 0.77
R1498:Wdr36 UTSW 18 32852968 missense possibly damaging 0.95
R3522:Wdr36 UTSW 18 32861485 splice site probably null
R4902:Wdr36 UTSW 18 32859261 missense possibly damaging 0.51
R5482:Wdr36 UTSW 18 32841904 missense probably benign 0.19
R5574:Wdr36 UTSW 18 32865959 missense probably damaging 1.00
R5627:Wdr36 UTSW 18 32861638 missense possibly damaging 0.73
R6076:Wdr36 UTSW 18 32846945 missense probably damaging 1.00
R6186:Wdr36 UTSW 18 32852901 missense probably benign 0.19
R6228:Wdr36 UTSW 18 32842006 missense possibly damaging 0.67
R7027:Wdr36 UTSW 18 32841905 missense probably benign 0.04
R7112:Wdr36 UTSW 18 32839451 missense probably benign 0.34
R7635:Wdr36 UTSW 18 32850525 missense probably benign 0.19
R7642:Wdr36 UTSW 18 32854571 splice site probably null
R7998:Wdr36 UTSW 18 32852519 missense probably damaging 1.00
R8200:Wdr36 UTSW 18 32865926 missense probably benign 0.10
R8203:Wdr36 UTSW 18 32852083 nonsense probably null
R8334:Wdr36 UTSW 18 32859293 missense possibly damaging 0.95
X0063:Wdr36 UTSW 18 32864722 missense probably damaging 0.96
Z1088:Wdr36 UTSW 18 32866012 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTGATATCTACTAGATGTCCAAATGCC -3'
(R):5'- AGTTTCCCCACAGCTAACAG -3'

Sequencing Primer
(F):5'- TTTCCCAATTTCTTAAAAAGCTTCTC -3'
(R):5'- AGCTAACAGCCCCTGATGG -3'
Posted On2015-08-18