Mutagenetix > Incidental Mutation

Incidental Mutation 'R4521:Rbm20'

334246

Institutional Source

Beutler Lab

Gene Symbol

Rbm20

Ensembl Gene

ENSMUSG00000043639

Gene Name

RNA binding motif protein 20

Synonyms

2010003H22Rik, 1110018J23Rik

MMRRC Submission

041764-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.133) question?

Stock #

R4521 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53677306-53867080 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 53817202 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 466 (N466S)

Ref Sequence

ENSEMBL: ENSMUSP00000093665 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095969] [ENSMUST00000164202]

AlphaFold

Q3UQS8

Predicted Effect

probably benign
Transcript: ENSMUST00000095969
AA Change: N466S

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000093665
Gene: ENSMUSG00000043639
AA Change: N466S

Domain	Start	End	E-Value	Type
low complexity region	25	61	N/A	INTRINSIC
low complexity region	106	117	N/A	INTRINSIC
low complexity region	170	183	N/A	INTRINSIC
low complexity region	251	260	N/A	INTRINSIC
ZnF_C2H2	413	437	4.69e0	SMART
RRM	521	591	4.01e-5	SMART
low complexity region	634	657	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162724

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162910

Predicted Effect

probably benign
Transcript: ENSMUST00000164202
AA Change: N466S

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000129447
Gene: ENSMUSG00000043639
AA Change: N466S

Domain	Start	End	E-Value	Type
low complexity region	25	61	N/A	INTRINSIC
low complexity region	106	117	N/A	INTRINSIC
low complexity region	170	183	N/A	INTRINSIC
low complexity region	251	260	N/A	INTRINSIC
ZnF_U1	410	444	6.79e-1	SMART
ZnF_C2H2	413	437	4.69e0	SMART
RRM	521	591	4.01e-5	SMART
low complexity region	634	657	N/A	INTRINSIC
low complexity region	804	815	N/A	INTRINSIC
low complexity region	833	844	N/A	INTRINSIC
ZnF_U1	1130	1165	7.26e-6	SMART
ZnF_C2H2	1133	1158	3.13e1	SMART

Meta Mutation Damage Score

0.0946

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an allele lacking the RNA recognition motif exhibit increased titin compliance, and attenuated Frank-Starling mechanism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	A	G	10: 50,660,670	N700D	probably benign	Het
Bora	G	T	14: 99,068,548	S451I	probably damaging	Het
Cadm3	A	T	1: 173,345,063		probably null	Het
Car14	A	G	3: 95,904,378		probably benign	Het
Ccdc88c	G	T	12: 100,913,332	S1843R	possibly damaging	Het
Cdc20b	A	G	13: 113,081,191	I381M	probably damaging	Het
Col12a1	C	T	9: 79,633,357	V2449I	probably benign	Het
Crb2	T	C	2: 37,795,337		probably benign	Het
Dcaf6	A	T	1: 165,390,490	D347E	probably damaging	Het
Dlgap2	G	A	8: 14,727,871	R372H	probably damaging	Het
Fat3	T	C	9: 15,922,942	N4118S	probably null	Het
Fbxo41	A	G	6: 85,484,042	I228T	probably damaging	Het
Fpr2	A	C	17: 17,893,247	R168S	probably benign	Het
Ghr	A	G	15: 3,325,958	I281T	probably damaging	Het
Glmp	C	A	3: 88,328,039	N259K	possibly damaging	Het
Grhl3	T	C	4: 135,546,250	K564E	probably damaging	Het
Helz2	T	C	2: 181,228,833	H2875R	probably benign	Het
Lcp1	A	G	14: 75,215,168	D438G	possibly damaging	Het
Lrfn2	T	A	17: 49,069,894	M1K	probably null	Het
Lrp6	A	G	6: 134,485,862	C612R	probably damaging	Het
Map3k13	T	C	16: 21,905,775	V341A	possibly damaging	Het
Megf8	T	A	7: 25,342,701	C1315S	probably benign	Het
Mrgpra9	A	T	7: 47,235,190	L243H	probably damaging	Het
Mrgprx1	T	C	7: 48,021,699	D100G	probably benign	Het
Nop2	G	T	6: 125,133,552	R47L	probably damaging	Het
Nup93	T	C	8: 94,314,636	Y801H	probably damaging	Het
Olfr623	C	T	7: 103,660,332	R306H	probably benign	Het
Olfr810	T	A	10: 129,791,181	N136I	possibly damaging	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Plce1	T	C	19: 38,524,319	S21P	possibly damaging	Het
Plpp2	A	G	10: 79,530,625	Y118H	probably damaging	Het
Ppwd1	A	G	13: 104,209,659	V496A	probably benign	Het
Rpl10l	T	C	12: 66,283,738	D207G	probably benign	Het
Skida1	T	C	2: 18,045,872		probably benign	Het
Stk17b	A	G	1: 53,764,038	Y73H	probably damaging	Het
Tapbpl	A	G	6: 125,228,122	I287T	probably damaging	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Topbp1	T	C	9: 103,334,202		probably benign	Het
Tsen54	G	A	11: 115,817,106		probably null	Het
Ttn	G	A	2: 76,725,216	R28736*	probably null	Het
Wdr36	G	A	18: 32,841,148		probably null	Het

Other mutations in Rbm20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Rbm20	APN	19	53843264	missense	probably damaging	1.00
IGL00815:Rbm20	APN	19	53815517	missense	probably damaging	1.00
IGL00845:Rbm20	APN	19	53817949	missense	probably damaging	1.00
IGL01408:Rbm20	APN	19	53851613	missense	possibly damaging	0.95
IGL01663:Rbm20	APN	19	53840995	missense	probably damaging	1.00
IGL01902:Rbm20	APN	19	53840991	missense	probably damaging	0.99
IGL01942:Rbm20	APN	19	53813443	missense	probably damaging	1.00
IGL02964:Rbm20	APN	19	53813702	missense	probably benign	0.02
IGL03326:Rbm20	APN	19	53814000	missense	possibly damaging	0.85
BB001:Rbm20	UTSW	19	53677585	missense	possibly damaging	0.63
BB002:Rbm20	UTSW	19	53813322	missense	probably damaging	0.97
BB011:Rbm20	UTSW	19	53677585	missense	possibly damaging	0.63
BB012:Rbm20	UTSW	19	53813322	missense	probably damaging	0.97
R0326:Rbm20	UTSW	19	53864165	missense	probably damaging	1.00
R0487:Rbm20	UTSW	19	53851195	missense	probably damaging	1.00
R0965:Rbm20	UTSW	19	53859401	missense	probably damaging	1.00
R1435:Rbm20	UTSW	19	53814157	missense	probably benign	0.16
R1914:Rbm20	UTSW	19	53864087	missense	probably damaging	1.00
R1915:Rbm20	UTSW	19	53864087	missense	probably damaging	1.00
R2011:Rbm20	UTSW	19	53859428	missense	probably damaging	1.00
R2012:Rbm20	UTSW	19	53859428	missense	probably damaging	1.00
R2258:Rbm20	UTSW	19	53851741	missense	probably benign
R3947:Rbm20	UTSW	19	53813337	missense	probably benign	0.35
R4305:Rbm20	UTSW	19	53843260	missense	probably damaging	1.00
R4308:Rbm20	UTSW	19	53843260	missense	probably damaging	1.00
R4970:Rbm20	UTSW	19	53851669	missense	probably damaging	0.99
R5266:Rbm20	UTSW	19	53813387	missense	probably damaging	1.00
R5475:Rbm20	UTSW	19	53834705	nonsense	probably null
R5503:Rbm20	UTSW	19	53851354	missense	possibly damaging	0.75
R5995:Rbm20	UTSW	19	53851267	missense	possibly damaging	0.95
R6836:Rbm20	UTSW	19	53814069	missense	probably damaging	0.98
R6947:Rbm20	UTSW	19	53851265	missense	probably damaging	1.00
R7030:Rbm20	UTSW	19	53834766	missense	probably damaging	1.00
R7117:Rbm20	UTSW	19	53851558	missense	possibly damaging	0.92
R7237:Rbm20	UTSW	19	53851499	missense	probably benign	0.04
R7638:Rbm20	UTSW	19	53814333	missense	possibly damaging	0.95
R7792:Rbm20	UTSW	19	53850136	missense	probably benign
R7823:Rbm20	UTSW	19	53843354	missense	probably benign	0.33
R7924:Rbm20	UTSW	19	53677585	missense	possibly damaging	0.63
R7925:Rbm20	UTSW	19	53813322	missense	probably damaging	0.97
R8044:Rbm20	UTSW	19	53817971	missense	probably benign	0.44
R8045:Rbm20	UTSW	19	53817971	missense	probably benign	0.44
R8046:Rbm20	UTSW	19	53817971	missense	probably benign	0.44
R8100:Rbm20	UTSW	19	53851313	missense	possibly damaging	0.85
R8292:Rbm20	UTSW	19	53851499	missense	possibly damaging	0.71
R8366:Rbm20	UTSW	19	53850181	missense	possibly damaging	0.95
R8518:Rbm20	UTSW	19	53851492	missense	probably benign	0.18
R8799:Rbm20	UTSW	19	53832689	missense	probably damaging	1.00
R8873:Rbm20	UTSW	19	53677480	missense	probably benign	0.00
R8886:Rbm20	UTSW	19	53813336	missense	probably benign	0.00
R9194:Rbm20	UTSW	19	53834700	missense	probably damaging	1.00
R9226:Rbm20	UTSW	19	53851214	missense	possibly damaging	0.92
R9765:Rbm20	UTSW	19	53851629	missense	probably benign
R9793:Rbm20	UTSW	19	53864120	missense	probably benign	0.03
R9795:Rbm20	UTSW	19	53864120	missense	probably benign	0.03
RF016:Rbm20	UTSW	19	53813732	missense	probably benign	0.00
Z1177:Rbm20	UTSW	19	53851685	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTTCTTGTGGTAAAGCTCATTACG -3'
(R):5'- CCCAGAGAACTTTGTCGGTG -3'

Sequencing Primer
(F):5'- TCTGCTGACGAACACTTGAG -3'
(R):5'- TGTTGGGACCTGCTGCC -3'

Posted On

2015-08-18