Mutagenetix > Incidental Mutation

Incidental Mutation 'R4522:Speg'

334249

Institutional Source

Beutler Lab

Gene Symbol

Speg

Ensembl Gene

ENSMUSG00000026207

Gene Name

SPEG complex locus

Synonyms

SPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG

MMRRC Submission

041765-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4522 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75375297-75432320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75428330 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 2922 (E2922G)

Ref Sequence

ENSEMBL: ENSMUSP00000084361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087122]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000087122
AA Change: E2922G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: E2922G

Domain	Start	End	E-Value	Type
IG	51	128	1.48e-6	SMART
low complexity region	292	318	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	359	368	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
IGc2	739	806	2.19e-9	SMART
Pfam:SPEG_u2	817	873	2.4e-36	PFAM
IGc2	886	954	4.03e-8	SMART
IG	979	1064	1.05e-6	SMART
IGc2	1081	1148	2.19e-9	SMART
IG	1199	1283	6.87e-2	SMART
FN3	1287	1373	1.38e-4	SMART
IG	1401	1487	2.64e-3	SMART
IGc2	1502	1569	1.12e-6	SMART
STYKc	1606	1859	8.44e-63	SMART
Blast:STYKc	1861	1895	6e-12	BLAST
low complexity region	1918	1939	N/A	INTRINSIC
low complexity region	2069	2081	N/A	INTRINSIC
low complexity region	2208	2227	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2255	2269	N/A	INTRINSIC
low complexity region	2343	2366	N/A	INTRINSIC
low complexity region	2410	2422	N/A	INTRINSIC
low complexity region	2433	2451	N/A	INTRINSIC
low complexity region	2457	2487	N/A	INTRINSIC
low complexity region	2524	2544	N/A	INTRINSIC
IGc2	2599	2667	2.05e-9	SMART
FN3	2681	2760	2.5e-2	SMART
low complexity region	2775	2789	N/A	INTRINSIC
low complexity region	2802	2831	N/A	INTRINSIC
low complexity region	2912	2927	N/A	INTRINSIC
STYKc	2961	3213	4.42e-66	SMART
low complexity region	3241	3250	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000137868
AA Change: E2669G

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143679

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	A	G	10: 50,660,670 (GRCm38)	N700D	probably benign	Het
Babam2	G	A	5: 32,007,242 (GRCm38)	V287M	probably damaging	Het
Brip1	T	C	11: 86,189,801 (GRCm38)	I146M	possibly damaging	Het
Cacna1b	C	T	2: 24,654,430 (GRCm38)	R1248H	probably damaging	Het
Ccdc88c	G	T	12: 100,913,332 (GRCm38)	S1843R	possibly damaging	Het
Chaf1b	G	A	16: 93,901,295 (GRCm38)	A485T	probably benign	Het
Dock7	T	C	4: 98,962,224 (GRCm38)	R1594G	probably damaging	Het
Fam122c	G	A	X: 53,293,499 (GRCm38)	R94H	possibly damaging	Het
Fbxo41	A	G	6: 85,484,042 (GRCm38)	I228T	probably damaging	Het
Gm3739	T	A	14: 7,299,398 (GRCm38)	K86*	probably null	Het
Gm7173	A	T	X: 79,509,995 (GRCm38)	N291K	possibly damaging	Het
Mark2	A	T	19: 7,285,948 (GRCm38)	D151E	probably damaging	Het
Nop2	G	T	6: 125,133,552 (GRCm38)	R47L	probably damaging	Het
Nwd1	A	T	8: 72,670,951 (GRCm38)	D606V	probably damaging	Het
Olfr1132	T	A	2: 87,635,151 (GRCm38)	I199L	probably benign	Het
Pcbp1	T	C	6: 86,525,050 (GRCm38)	N289S	probably benign	Het
Plce1	T	C	19: 38,524,319 (GRCm38)	S21P	possibly damaging	Het
Ptpn18	T	C	1: 34,472,960 (GRCm38)	L55P	probably benign	Het
Rpl10l	T	C	12: 66,283,738 (GRCm38)	D207G	probably benign	Het
Rufy4	T	C	1: 74,147,663 (GRCm38)	C537R	probably damaging	Het
Sec23b	T	A	2: 144,578,366 (GRCm38)	I450N	possibly damaging	Het
Spem1	C	A	11: 69,821,805 (GRCm38)		probably null	Het
Stxbp3-ps	A	T	19: 9,559,110 (GRCm38)		noncoding transcript	Het
Tmem38a	C	T	8: 72,572,161 (GRCm38)	P20S	possibly damaging	Het
Tmod2	T	C	9: 75,592,584 (GRCm38)	T129A	probably benign	Het
Ttc28	A	G	5: 111,280,172 (GRCm38)	T1845A	probably benign	Het
Ubqlnl	C	T	7: 104,149,718 (GRCm38)	V191M	probably benign	Het
Ush2a	C	T	1: 188,864,625 (GRCm38)	T3854M	probably damaging	Het
Vmn2r72	T	A	7: 85,751,926 (GRCm38)	H95L	probably benign	Het
Xdh	C	A	17: 73,898,344 (GRCm38)	G1042V	probably damaging	Het
Zfp105	T	A	9: 122,930,056 (GRCm38)	V264E	possibly damaging	Het

Other mutations in Speg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Speg	APN	1	75,410,390 (GRCm38)	missense	possibly damaging	0.95
IGL00979:Speg	APN	1	75,410,734 (GRCm38)	missense	probably damaging	0.98
IGL01122:Speg	APN	1	75,410,035 (GRCm38)	missense	probably damaging	1.00
IGL01293:Speg	APN	1	75,388,102 (GRCm38)	missense	probably damaging	1.00
IGL01304:Speg	APN	1	75,428,197 (GRCm38)	missense	probably benign	0.00
IGL01351:Speg	APN	1	75,411,276 (GRCm38)	splice site	probably benign
IGL01473:Speg	APN	1	75,428,285 (GRCm38)	missense	possibly damaging	0.53
IGL01477:Speg	APN	1	75,391,897 (GRCm38)	missense	probably damaging	1.00
IGL01485:Speg	APN	1	75,387,827 (GRCm38)	missense	probably damaging	1.00
IGL01584:Speg	APN	1	75,430,937 (GRCm38)	missense	probably damaging	1.00
IGL01959:Speg	APN	1	75,391,090 (GRCm38)	missense	probably damaging	1.00
IGL02231:Speg	APN	1	75,423,387 (GRCm38)	missense	probably damaging	1.00
IGL02355:Speg	APN	1	75,423,915 (GRCm38)	missense	possibly damaging	0.49
IGL02362:Speg	APN	1	75,423,915 (GRCm38)	missense	possibly damaging	0.49
IGL03013:Speg	APN	1	75,431,279 (GRCm38)	missense	probably damaging	0.97
IGL03168:Speg	APN	1	75,388,187 (GRCm38)	missense	probably damaging	1.00
H8562:Speg	UTSW	1	75,415,597 (GRCm38)	missense	probably benign	0.39
R0112:Speg	UTSW	1	75,385,032 (GRCm38)	missense	possibly damaging	0.92
R0311:Speg	UTSW	1	75,430,937 (GRCm38)	missense	probably damaging	1.00
R0315:Speg	UTSW	1	75,415,136 (GRCm38)	missense	possibly damaging	0.88
R0393:Speg	UTSW	1	75,423,924 (GRCm38)	missense	possibly damaging	0.46
R0403:Speg	UTSW	1	75,430,784 (GRCm38)	splice site	probably benign
R0483:Speg	UTSW	1	75,385,032 (GRCm38)	missense	possibly damaging	0.92
R0648:Speg	UTSW	1	75,427,978 (GRCm38)	missense	probably benign
R0683:Speg	UTSW	1	75,429,118 (GRCm38)	missense	probably damaging	1.00
R0800:Speg	UTSW	1	75,423,489 (GRCm38)	missense	probably damaging	1.00
R0815:Speg	UTSW	1	75,415,392 (GRCm38)	missense	probably damaging	1.00
R0835:Speg	UTSW	1	75,375,674 (GRCm38)	missense	probably benign	0.00
R0866:Speg	UTSW	1	75,417,083 (GRCm38)	missense	probably damaging	0.99
R0880:Speg	UTSW	1	75,405,061 (GRCm38)	missense	probably damaging	1.00
R1082:Speg	UTSW	1	75,415,138 (GRCm38)	missense	possibly damaging	0.94
R1140:Speg	UTSW	1	75,429,095 (GRCm38)	missense	probably damaging	1.00
R1252:Speg	UTSW	1	75,427,095 (GRCm38)	missense	probably damaging	1.00
R1301:Speg	UTSW	1	75,401,501 (GRCm38)	missense	probably damaging	1.00
R1348:Speg	UTSW	1	75,422,872 (GRCm38)	missense	probably damaging	0.99
R1388:Speg	UTSW	1	75,430,460 (GRCm38)	missense	probably damaging	0.99
R1465:Speg	UTSW	1	75,428,484 (GRCm38)	splice site	probably benign
R1505:Speg	UTSW	1	75,375,542 (GRCm38)	missense	probably benign	0.02
R1506:Speg	UTSW	1	75,417,663 (GRCm38)	missense	probably benign	0.03
R1531:Speg	UTSW	1	75,401,222 (GRCm38)	missense	possibly damaging	0.86
R1543:Speg	UTSW	1	75,421,951 (GRCm38)	missense	probably damaging	1.00
R1567:Speg	UTSW	1	75,428,047 (GRCm38)	missense	probably benign
R1630:Speg	UTSW	1	75,422,977 (GRCm38)	missense	probably damaging	1.00
R1667:Speg	UTSW	1	75,410,549 (GRCm38)	splice site	probably benign
R1673:Speg	UTSW	1	75,411,163 (GRCm38)	missense	possibly damaging	0.60
R1718:Speg	UTSW	1	75,421,744 (GRCm38)	missense	possibly damaging	0.87
R1718:Speg	UTSW	1	75,417,863 (GRCm38)	missense	probably benign	0.00
R1719:Speg	UTSW	1	75,417,863 (GRCm38)	missense	probably benign	0.00
R1759:Speg	UTSW	1	75,401,162 (GRCm38)	missense	possibly damaging	0.95
R1861:Speg	UTSW	1	75,389,005 (GRCm38)	missense	probably damaging	1.00
R1874:Speg	UTSW	1	75,423,906 (GRCm38)	missense	probably benign
R1936:Speg	UTSW	1	75,431,408 (GRCm38)	missense	possibly damaging	0.93
R2192:Speg	UTSW	1	75,417,727 (GRCm38)	missense	probably damaging	1.00
R2204:Speg	UTSW	1	75,430,477 (GRCm38)	missense	probably benign	0.30
R2287:Speg	UTSW	1	75,430,465 (GRCm38)	missense	possibly damaging	0.76
R2696:Speg	UTSW	1	75,406,926 (GRCm38)	missense	probably benign	0.27
R2983:Speg	UTSW	1	75,384,930 (GRCm38)	missense	possibly damaging	0.83
R3110:Speg	UTSW	1	75,422,682 (GRCm38)	nonsense	probably null
R3112:Speg	UTSW	1	75,422,682 (GRCm38)	nonsense	probably null
R3154:Speg	UTSW	1	75,401,542 (GRCm38)	missense	probably damaging	1.00
R3720:Speg	UTSW	1	75,426,782 (GRCm38)	missense	probably damaging	1.00
R3983:Speg	UTSW	1	75,422,547 (GRCm38)	missense	probably benign	0.27
R4133:Speg	UTSW	1	75,427,904 (GRCm38)	missense	probably benign
R4564:Speg	UTSW	1	75,391,834 (GRCm38)	missense	probably damaging	1.00
R4577:Speg	UTSW	1	75,415,395 (GRCm38)	missense	probably damaging	1.00
R4858:Speg	UTSW	1	75,421,735 (GRCm38)	missense	probably damaging	1.00
R4953:Speg	UTSW	1	75,423,864 (GRCm38)	missense	possibly damaging	0.72
R4965:Speg	UTSW	1	75,427,703 (GRCm38)	missense	probably damaging	1.00
R4967:Speg	UTSW	1	75,387,869 (GRCm38)	missense	probably damaging	1.00
R5152:Speg	UTSW	1	75,428,098 (GRCm38)	missense	possibly damaging	0.92
R5156:Speg	UTSW	1	75,428,087 (GRCm38)	missense	probably damaging	0.99
R5371:Speg	UTSW	1	75,431,393 (GRCm38)	missense	possibly damaging	0.50
R5550:Speg	UTSW	1	75,429,100 (GRCm38)	missense	probably damaging	1.00
R5562:Speg	UTSW	1	75,427,056 (GRCm38)	missense	probably damaging	1.00
R5687:Speg	UTSW	1	75,419,129 (GRCm38)	splice site	probably null
R5985:Speg	UTSW	1	75,406,684 (GRCm38)	missense	possibly damaging	0.94
R6004:Speg	UTSW	1	75,415,603 (GRCm38)	nonsense	probably null
R6038:Speg	UTSW	1	75,418,459 (GRCm38)	critical splice donor site	probably null
R6038:Speg	UTSW	1	75,418,459 (GRCm38)	critical splice donor site	probably null
R6143:Speg	UTSW	1	75,414,387 (GRCm38)	missense	probably damaging	1.00
R6265:Speg	UTSW	1	75,406,679 (GRCm38)	nonsense	probably null
R6347:Speg	UTSW	1	75,426,875 (GRCm38)	missense	probably benign	0.00
R6453:Speg	UTSW	1	75,417,972 (GRCm38)	missense	probably benign	0.06
R6505:Speg	UTSW	1	75,429,523 (GRCm38)	missense	possibly damaging	0.93
R6505:Speg	UTSW	1	75,406,684 (GRCm38)	missense	possibly damaging	0.94
R6531:Speg	UTSW	1	75,422,757 (GRCm38)	missense	probably benign	0.03
R6566:Speg	UTSW	1	75,388,463 (GRCm38)	missense	probably damaging	1.00
R6747:Speg	UTSW	1	75,410,395 (GRCm38)	critical splice donor site	probably null
R6819:Speg	UTSW	1	75,391,812 (GRCm38)	missense	possibly damaging	0.56
R6821:Speg	UTSW	1	75,417,903 (GRCm38)	missense	possibly damaging	0.83
R6919:Speg	UTSW	1	75,387,908 (GRCm38)	nonsense	probably null
R6981:Speg	UTSW	1	75,430,913 (GRCm38)	missense	probably damaging	1.00
R7002:Speg	UTSW	1	75,423,268 (GRCm38)	missense	probably damaging	0.98
R7082:Speg	UTSW	1	75,411,447 (GRCm38)	missense	probably damaging	0.96
R7140:Speg	UTSW	1	75,406,770 (GRCm38)	critical splice donor site	probably null
R7175:Speg	UTSW	1	75,422,490 (GRCm38)	missense	probably benign	0.01
R7178:Speg	UTSW	1	75,422,383 (GRCm38)	missense	possibly damaging	0.46
R7345:Speg	UTSW	1	75,384,835 (GRCm38)	missense	probably damaging	0.97
R7420:Speg	UTSW	1	75,430,905 (GRCm38)	missense	probably damaging	1.00
R7537:Speg	UTSW	1	75,401,464 (GRCm38)	missense	probably damaging	1.00
R7562:Speg	UTSW	1	75,431,279 (GRCm38)	missense	probably damaging	0.97
R7615:Speg	UTSW	1	75,429,242 (GRCm38)	missense	probably damaging	1.00
R7679:Speg	UTSW	1	75,406,315 (GRCm38)	missense	probably damaging	1.00
R7692:Speg	UTSW	1	75,401,190 (GRCm38)	missense	probably benign	0.04
R7696:Speg	UTSW	1	75,429,161 (GRCm38)	missense	probably damaging	1.00
R7719:Speg	UTSW	1	75,375,825 (GRCm38)	missense	probably damaging	1.00
R7794:Speg	UTSW	1	75,388,870 (GRCm38)	missense	probably benign	0.00
R7824:Speg	UTSW	1	75,384,017 (GRCm38)	splice site	probably null
R7834:Speg	UTSW	1	75,384,927 (GRCm38)	missense	probably damaging	1.00
R7892:Speg	UTSW	1	75,427,166 (GRCm38)	missense	probably damaging	1.00
R8015:Speg	UTSW	1	75,415,421 (GRCm38)	splice site	probably benign
R8068:Speg	UTSW	1	75,422,250 (GRCm38)	missense	probably damaging	1.00
R8085:Speg	UTSW	1	75,415,353 (GRCm38)	missense	probably damaging	1.00
R8130:Speg	UTSW	1	75,415,596 (GRCm38)	missense	probably damaging	1.00
R8132:Speg	UTSW	1	75,422,995 (GRCm38)	missense	probably damaging	1.00
R8239:Speg	UTSW	1	75,419,033 (GRCm38)	missense	probably damaging	1.00
R8287:Speg	UTSW	1	75,422,236 (GRCm38)	missense	probably benign	0.26
R8299:Speg	UTSW	1	75,387,836 (GRCm38)	missense	possibly damaging	0.95
R8441:Speg	UTSW	1	75,411,332 (GRCm38)	missense	possibly damaging	0.60
R8468:Speg	UTSW	1	75,431,309 (GRCm38)	missense	probably damaging	1.00
R8555:Speg	UTSW	1	75,402,264 (GRCm38)	splice site	probably null
R8781:Speg	UTSW	1	75,407,021 (GRCm38)	missense	probably damaging	1.00
R8784:Speg	UTSW	1	75,405,149 (GRCm38)	critical splice donor site	probably benign
R8848:Speg	UTSW	1	75,427,438 (GRCm38)	critical splice donor site	probably null
R8881:Speg	UTSW	1	75,401,151 (GRCm38)	missense	possibly damaging	0.67
R8898:Speg	UTSW	1	75,388,873 (GRCm38)	missense	probably damaging	1.00
R8935:Speg	UTSW	1	75,422,606 (GRCm38)	missense	probably benign	0.30
R9019:Speg	UTSW	1	75,429,238 (GRCm38)	missense	probably damaging	1.00
R9027:Speg	UTSW	1	75,388,432 (GRCm38)	missense	possibly damaging	0.67
R9066:Speg	UTSW	1	75,385,010 (GRCm38)	missense	probably damaging	0.99
R9092:Speg	UTSW	1	75,422,734 (GRCm38)	missense	probably benign	0.01
R9117:Speg	UTSW	1	75,387,800 (GRCm38)	missense	probably damaging	1.00
R9202:Speg	UTSW	1	75,390,993 (GRCm38)	missense	probably damaging	1.00
R9246:Speg	UTSW	1	75,384,854 (GRCm38)	missense	probably damaging	1.00
R9248:Speg	UTSW	1	75,421,776 (GRCm38)	missense	probably damaging	1.00
R9451:Speg	UTSW	1	75,417,733 (GRCm38)	missense	probably damaging	1.00
R9452:Speg	UTSW	1	75,422,508 (GRCm38)	missense	probably benign
R9475:Speg	UTSW	1	75,388,091 (GRCm38)	missense	probably damaging	1.00
R9476:Speg	UTSW	1	75,401,124 (GRCm38)	missense	probably damaging	0.99
R9510:Speg	UTSW	1	75,401,124 (GRCm38)	missense	probably damaging	0.99
R9519:Speg	UTSW	1	75,415,736 (GRCm38)	missense	probably damaging	1.00
R9528:Speg	UTSW	1	75,387,803 (GRCm38)	missense	possibly damaging	0.78
R9542:Speg	UTSW	1	75,422,782 (GRCm38)	missense	probably benign	0.08
R9553:Speg	UTSW	1	75,418,001 (GRCm38)	missense	probably benign	0.00
R9767:Speg	UTSW	1	75,427,181 (GRCm38)	missense	possibly damaging	0.78
R9768:Speg	UTSW	1	75,418,973 (GRCm38)	nonsense	probably null
R9800:Speg	UTSW	1	75,422,714 (GRCm38)	missense	probably benign	0.03
X0025:Speg	UTSW	1	75,422,457 (GRCm38)	missense	probably damaging	1.00
X0026:Speg	UTSW	1	75,423,475 (GRCm38)	missense	possibly damaging	0.88
Z1176:Speg	UTSW	1	75,406,594 (GRCm38)	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75,427,683 (GRCm38)	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75,430,455 (GRCm38)	missense	probably damaging	0.99
Z1177:Speg	UTSW	1	75,428,381 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCCTCACTCAAGGCTGTG -3'
(R):5'- ACACTGTTCTCTGAATCCAAACTG -3'

Sequencing Primer
(F):5'- AAAGCACAGGGGCCTTCTG -3'
(R):5'- CTGAATCCAAACTGTATCCCTTG -3'

Posted On

2015-08-18