Incidental Mutation 'R4522:Olfr1132'
ID334256
Institutional Source Beutler Lab
Gene Symbol Olfr1132
Ensembl Gene ENSMUSG00000068818
Gene Nameolfactory receptor 1132
SynonymsMOR177-1, GA_x6K02T2Q125-49140947-49140021
MMRRC Submission 041765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R4522 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87632583-87637535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87635151 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 199 (I199L)
Ref Sequence ENSEMBL: ENSMUSP00000149683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090711] [ENSMUST00000213302] [ENSMUST00000216082] [ENSMUST00000216756]
Predicted Effect probably benign
Transcript: ENSMUST00000090711
AA Change: I199L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088213
Gene: ENSMUSG00000068818
AA Change: I199L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-45 PFAM
Pfam:7tm_1 41 290 4.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213302
Predicted Effect probably benign
Transcript: ENSMUST00000216082
AA Change: I199L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216756
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Babam2 G A 5: 32,007,242 V287M probably damaging Het
Brip1 T C 11: 86,189,801 I146M possibly damaging Het
Cacna1b C T 2: 24,654,430 R1248H probably damaging Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Chaf1b G A 16: 93,901,295 A485T probably benign Het
Dock7 T C 4: 98,962,224 R1594G probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Mark2 A T 19: 7,285,948 D151E probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nwd1 A T 8: 72,670,951 D606V probably damaging Het
Pcbp1 T C 6: 86,525,050 N289S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ptpn18 T C 1: 34,472,960 L55P probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23b T A 2: 144,578,366 I450N possibly damaging Het
Speg A G 1: 75,428,330 E2922G probably damaging Het
Spem1 C A 11: 69,821,805 probably null Het
Stxbp3-ps A T 19: 9,559,110 noncoding transcript Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmod2 T C 9: 75,592,584 T129A probably benign Het
Ttc28 A G 5: 111,280,172 T1845A probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ush2a C T 1: 188,864,625 T3854M probably damaging Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zfp105 T A 9: 122,930,056 V264E possibly damaging Het
Other mutations in Olfr1132
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Olfr1132 APN 2 87635384 missense probably damaging 1.00
IGL01780:Olfr1132 APN 2 87635080 missense possibly damaging 0.56
R1235:Olfr1132 UTSW 2 87634815 splice site probably null
R1471:Olfr1132 UTSW 2 87635670 missense probably benign
R2106:Olfr1132 UTSW 2 87635159 missense probably benign 0.22
R3711:Olfr1132 UTSW 2 87635681 missense probably benign
R4024:Olfr1132 UTSW 2 87635155 missense probably damaging 0.97
R6531:Olfr1132 UTSW 2 87635529 missense probably damaging 1.00
R7768:Olfr1132 UTSW 2 87635313 missense probably benign
R8036:Olfr1132 UTSW 2 87635503 missense probably benign 0.36
R8158:Olfr1132 UTSW 2 87634889 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGAGCATAGTCCCCTGG -3'
(R):5'- GGCCATCAGTAACCCATTGC -3'

Sequencing Primer
(F):5'- GAGCATAGTCCCCTGGAATACTG -3'
(R):5'- TGCTCTACACAGTGAACATGTC -3'
Posted On2015-08-18