Incidental Mutation 'R4522:Sec23b'
ID334257
Institutional Source Beutler Lab
Gene Symbol Sec23b
Ensembl Gene ENSMUSG00000027429
Gene NameSEC23 homolog B, COPII coat complex component
Synonyms
MMRRC Submission 041765-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4522 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location144556229-144590749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144578366 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 450 (I450N)
Ref Sequence ENSEMBL: ENSMUSP00000028916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028916]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028916
AA Change: I450N

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028916
Gene: ENSMUSG00000027429
AA Change: I450N

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 58 98 4.3e-17 PFAM
Pfam:Sec23_trunk 126 392 2.3e-82 PFAM
Pfam:Sec23_BS 403 506 7.2e-33 PFAM
Pfam:Sec23_helical 522 620 1.1e-28 PFAM
Pfam:Gelsolin 631 720 1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146487
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC23 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec23p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The function of this gene product has been implicated in cargo selection and concentration. Multiple alternatively spliced transcript variants have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display complete neonatal lethality, fail to suckle, and show degeneration of the secretory tissues in the pancreas, salivary gland, and gastric glands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Babam2 G A 5: 32,007,242 V287M probably damaging Het
Brip1 T C 11: 86,189,801 I146M possibly damaging Het
Cacna1b C T 2: 24,654,430 R1248H probably damaging Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Chaf1b G A 16: 93,901,295 A485T probably benign Het
Dock7 T C 4: 98,962,224 R1594G probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Mark2 A T 19: 7,285,948 D151E probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nwd1 A T 8: 72,670,951 D606V probably damaging Het
Olfr1132 T A 2: 87,635,151 I199L probably benign Het
Pcbp1 T C 6: 86,525,050 N289S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ptpn18 T C 1: 34,472,960 L55P probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Speg A G 1: 75,428,330 E2922G probably damaging Het
Spem1 C A 11: 69,821,805 probably null Het
Stxbp3-ps A T 19: 9,559,110 noncoding transcript Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmod2 T C 9: 75,592,584 T129A probably benign Het
Ttc28 A G 5: 111,280,172 T1845A probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ush2a C T 1: 188,864,625 T3854M probably damaging Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zfp105 T A 9: 122,930,056 V264E possibly damaging Het
Other mutations in Sec23b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Sec23b APN 2 144583770 critical splice donor site probably null
IGL00668:Sec23b APN 2 144559218 utr 5 prime probably benign
IGL00714:Sec23b APN 2 144559225 missense probably benign 0.33
IGL00914:Sec23b APN 2 144566864 missense probably damaging 1.00
IGL01084:Sec23b APN 2 144564589 missense possibly damaging 0.81
IGL01341:Sec23b APN 2 144585733 missense probably benign 0.00
IGL01377:Sec23b APN 2 144559237 missense probably damaging 0.97
IGL01634:Sec23b APN 2 144559230 missense probably damaging 0.96
IGL02321:Sec23b APN 2 144579405 critical splice donor site probably null
IGL03027:Sec23b APN 2 144587545 missense possibly damaging 0.55
IGL03064:Sec23b APN 2 144582032 missense probably benign 0.00
IGL03105:Sec23b APN 2 144582020 missense probably damaging 1.00
IGL03240:Sec23b APN 2 144566759 splice site probably benign
R0004:Sec23b UTSW 2 144564562 splice site probably benign
R0092:Sec23b UTSW 2 144566910 missense probably benign 0.21
R0409:Sec23b UTSW 2 144567912 missense probably benign 0.22
R0426:Sec23b UTSW 2 144568612 unclassified probably benign
R0441:Sec23b UTSW 2 144581997 missense probably damaging 1.00
R1034:Sec23b UTSW 2 144590338 missense possibly damaging 0.87
R1624:Sec23b UTSW 2 144567129 missense probably benign
R2020:Sec23b UTSW 2 144566944 missense possibly damaging 0.49
R2392:Sec23b UTSW 2 144585587 splice site probably null
R3946:Sec23b UTSW 2 144581973 missense probably benign
R4407:Sec23b UTSW 2 144574718 missense possibly damaging 0.53
R4448:Sec23b UTSW 2 144559251 missense probably benign 0.43
R4519:Sec23b UTSW 2 144582015 missense possibly damaging 0.86
R4654:Sec23b UTSW 2 144572574 missense probably benign 0.33
R4849:Sec23b UTSW 2 144585599 missense probably damaging 0.96
R4876:Sec23b UTSW 2 144586361 splice site probably null
R4983:Sec23b UTSW 2 144581953 missense probably benign 0.06
R6169:Sec23b UTSW 2 144586974 missense probably damaging 1.00
R6702:Sec23b UTSW 2 144559189 splice site probably null
R6703:Sec23b UTSW 2 144559189 splice site probably null
R6748:Sec23b UTSW 2 144566794 missense probably damaging 1.00
R7238:Sec23b UTSW 2 144590338 missense possibly damaging 0.87
R7511:Sec23b UTSW 2 144590349 missense probably benign 0.30
R7845:Sec23b UTSW 2 144559396 missense possibly damaging 0.67
R7914:Sec23b UTSW 2 144564645 missense probably benign
R8177:Sec23b UTSW 2 144585623 missense probably benign 0.03
R8183:Sec23b UTSW 2 144559269 missense probably benign 0.08
R8238:Sec23b UTSW 2 144564648 missense probably benign 0.00
R8420:Sec23b UTSW 2 144559314 missense probably benign 0.01
R8488:Sec23b UTSW 2 144582063 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAAATGCAGCTTTCAGACTAATTCC -3'
(R):5'- AGTCTAACTAAATGCTGGAGGG -3'

Sequencing Primer
(F):5'- AGCTTTCAGACTAATTCCTTCTCAG -3'
(R):5'- AGGGAATTTTTAAAAGAGCACACC -3'
Posted On2015-08-18