Mutagenetix > Incidental Mutation

Incidental Mutation 'R4522:Babam2'

334261

Institutional Source

Beutler Lab

Gene Symbol

Babam2

Ensembl Gene

ENSMUSG00000052139

Gene Name

BRISC and BRCA1 A complex member 2

Synonyms

B830038C02Rik, 6030405P19Rik, Bre

MMRRC Submission

041765-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.740) question?

Stock #

R4522 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31855394-32242083 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 32164586 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 287 (V287M)

Ref Sequence

ENSEMBL: ENSMUSP00000144205 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063813] [ENSMUST00000071531] [ENSMUST00000114507] [ENSMUST00000114515] [ENSMUST00000131995] [ENSMUST00000200705] [ENSMUST00000201352]

AlphaFold

Q8K3W0

Predicted Effect

probably damaging
Transcript: ENSMUST00000063813
AA Change: V324M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000069133
Gene: ENSMUSG00000052139
AA Change: V324M

Domain	Start	End	E-Value	Type
Pfam:BRE	70	370	3.4e-133	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000071531
AA Change: V278M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000071462
Gene: ENSMUSG00000052139
AA Change: V278M

Domain	Start	End	E-Value	Type
Pfam:BRE	28	324	2.2e-204	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114507
AA Change: V223M

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110152
Gene: ENSMUSG00000052139
AA Change: V223M

Domain	Start	End	E-Value	Type
Pfam:BRE	3	269	9.5e-182	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114515
AA Change: V287M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110160
Gene: ENSMUSG00000052139
AA Change: V287M

Domain	Start	End	E-Value	Type
Pfam:BRE	1	333	4.9e-235	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000131995
AA Change: V149M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128351
Gene: ENSMUSG00000052139
AA Change: V149M

Domain	Start	End	E-Value	Type
Pfam:BRE	1	195	4.3e-131	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000200705

SMART Domains

Protein: ENSMUSP00000143964
Gene: ENSMUSG00000052139

Domain	Start	End	E-Value	Type
Pfam:BRE	8	204	1.6e-72	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201107

Predicted Effect

probably damaging
Transcript: ENSMUST00000201352
AA Change: V287M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144205
Gene: ENSMUSG00000052139
AA Change: V287M

Domain	Start	End	E-Value	Type
Pfam:BRE	8	333	8.1e-146	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201542

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an anti-apoptotic, death receptor-associated protein that interacts with tumor necrosis factor-receptor-1. The encoded protein acts as an adapter in several protein complexes, including the BRCA1-A complex and the BRISC complex. The BRCA1-A complex possesses ubiquitinase activity and targets sites of double strand DNA breaks, while the BRISC complex exhibits deubiquitinase activity and is involved in mitotic spindle assembly. This gene is upregulated in several types of cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are fertile. However, fibroblasts exhibit decreased proliferation and increased cellular replicative senescence in response to irradiation and hydrogen peroxide with impaired DNA damage repair. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	A	G	10: 50,536,766 (GRCm39)	N700D	probably benign	Het
Brip1	T	C	11: 86,080,627 (GRCm39)	I146M	possibly damaging	Het
Cacna1b	C	T	2: 24,544,442 (GRCm39)	R1248H	probably damaging	Het
Ccdc88c	G	T	12: 100,879,591 (GRCm39)	S1843R	possibly damaging	Het
Cfap47	A	T	X: 78,553,601 (GRCm39)	N291K	possibly damaging	Het
Chaf1b	G	A	16: 93,698,183 (GRCm39)	A485T	probably benign	Het
Dock7	T	C	4: 98,850,461 (GRCm39)	R1594G	probably damaging	Het
Fbxo41	A	G	6: 85,461,024 (GRCm39)	I228T	probably damaging	Het
Gm3739	T	A	14: 18,505,267 (GRCm39)	K86*	probably null	Het
Mark2	A	T	19: 7,263,313 (GRCm39)	D151E	probably damaging	Het
Nop2	G	T	6: 125,110,515 (GRCm39)	R47L	probably damaging	Het
Nwd1	A	T	8: 73,397,579 (GRCm39)	D606V	probably damaging	Het
Or8w1	T	A	2: 87,465,495 (GRCm39)	I199L	probably benign	Het
Pabir3	G	A	X: 52,382,376 (GRCm39)	R94H	possibly damaging	Het
Pcbp1	T	C	6: 86,502,032 (GRCm39)	N289S	probably benign	Het
Plce1	T	C	19: 38,512,763 (GRCm39)	S21P	possibly damaging	Het
Ptpn18	T	C	1: 34,512,041 (GRCm39)	L55P	probably benign	Het
Rpl10l	T	C	12: 66,330,512 (GRCm39)	D207G	probably benign	Het
Rufy4	T	C	1: 74,186,822 (GRCm39)	C537R	probably damaging	Het
Sec23b	T	A	2: 144,420,286 (GRCm39)	I450N	possibly damaging	Het
Speg	A	G	1: 75,404,974 (GRCm39)	E2922G	probably damaging	Het
Spem1	C	A	11: 69,712,631 (GRCm39)		probably null	Het
Stxbp3-ps	A	T	19: 9,536,474 (GRCm39)		noncoding transcript	Het
Tmem38a	C	T	8: 73,326,005 (GRCm39)	P20S	possibly damaging	Het
Tmod2	T	C	9: 75,499,866 (GRCm39)	T129A	probably benign	Het
Ttc28	A	G	5: 111,428,038 (GRCm39)	T1845A	probably benign	Het
Ubqlnl	C	T	7: 103,798,925 (GRCm39)	V191M	probably benign	Het
Ush2a	C	T	1: 188,596,822 (GRCm39)	T3854M	probably damaging	Het
Vmn2r72	T	A	7: 85,401,134 (GRCm39)	H95L	probably benign	Het
Xdh	C	A	17: 74,205,339 (GRCm39)	G1042V	probably damaging	Het
Zfp105	T	A	9: 122,759,121 (GRCm39)	V264E	possibly damaging	Het

Other mutations in Babam2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00844:Babam2	APN	5	32,164,651 (GRCm39)	missense	probably damaging	1.00
IGL01815:Babam2	APN	5	31,859,442 (GRCm39)	missense	possibly damaging	0.90
IGL02869:Babam2	APN	5	32,162,116 (GRCm39)	missense	possibly damaging	0.92
IGL03091:Babam2	APN	5	31,943,022 (GRCm39)	splice site	probably null
IGL03185:Babam2	APN	5	31,859,376 (GRCm39)	missense	possibly damaging	0.60
R1817:Babam2	UTSW	5	32,214,890 (GRCm39)	missense	probably damaging	0.99
R4012:Babam2	UTSW	5	32,158,782 (GRCm39)	missense	probably damaging	1.00
R4257:Babam2	UTSW	5	31,859,414 (GRCm39)	missense	possibly damaging	0.76
R4622:Babam2	UTSW	5	32,164,656 (GRCm39)	missense	probably damaging	0.99
R4738:Babam2	UTSW	5	32,058,486 (GRCm39)	missense	probably damaging	0.99
R4752:Babam2	UTSW	5	31,859,391 (GRCm39)	intron	probably benign
R4927:Babam2	UTSW	5	31,859,408 (GRCm39)	missense	probably benign	0.00
R4962:Babam2	UTSW	5	31,942,927 (GRCm39)	missense	possibly damaging	0.75
R5374:Babam2	UTSW	5	32,164,574 (GRCm39)	splice site	probably benign
R5375:Babam2	UTSW	5	31,859,207 (GRCm39)	missense	possibly damaging	0.52
R5453:Babam2	UTSW	5	32,164,590 (GRCm39)	missense	probably damaging	1.00
R5890:Babam2	UTSW	5	32,222,151 (GRCm39)	intron	probably benign
R5915:Babam2	UTSW	5	31,942,955 (GRCm39)	missense	probably damaging	1.00
R5982:Babam2	UTSW	5	31,977,964 (GRCm39)	missense	possibly damaging	0.86
R6271:Babam2	UTSW	5	32,158,706 (GRCm39)	missense	probably damaging	1.00
R7268:Babam2	UTSW	5	31,859,197 (GRCm39)	missense	probably damaging	1.00
R7352:Babam2	UTSW	5	32,164,594 (GRCm39)	nonsense	probably null
R7422:Babam2	UTSW	5	31,888,393 (GRCm39)	splice site	probably null
R9182:Babam2	UTSW	5	32,058,401 (GRCm39)	missense	possibly damaging	0.76
R9336:Babam2	UTSW	5	31,859,194 (GRCm39)	start codon destroyed	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- CTCATAACTGATGACTGATGTTTCC -3'
(R):5'- CTTCTGTGGGGCAACATCAC -3'

Sequencing Primer
(F):5'- ATTTCCTGCTAGATGAGGAAGC -3'
(R):5'- TCTGTGGGGCAACATCACATTAAAG -3'

Posted On

2015-08-18