Mutagenetix > Incidental Mutations

Incidental Mutation 'R4522:Fbxo41'

334263

Institutional Source

Beutler Lab

Gene Symbol

Fbxo41

Ensembl Gene

ENSMUSG00000047013

Gene Name

F-box protein 41

Synonyms

D6Ertd538e

MMRRC Submission

041765-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.359) question?

Stock #

R4522 (G1)

Quality Score

170

Status

Not validated

Chromosome

Chromosomal Location

85469574-85502994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85484042 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 228 (I228T)

Ref Sequence

ENSEMBL: ENSMUSP00000124754 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159062] [ENSMUST00000161078] [ENSMUST00000161546]

Predicted Effect

probably damaging
Transcript: ENSMUST00000159062
AA Change: I228T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125671
Gene: ENSMUSG00000047013
AA Change: I228T

Domain	Start	End	E-Value	Type
ZnF_C2H2	8	33	5.81e-2	SMART
low complexity region	65	77	N/A	INTRINSIC
low complexity region	100	122	N/A	INTRINSIC
low complexity region	162	192	N/A	INTRINSIC
SCOP:d1eq1a_	197	340	2e-5	SMART
low complexity region	352	374	N/A	INTRINSIC
low complexity region	425	440	N/A	INTRINSIC
Pfam:F-box	536	592	4.8e-5	PFAM
Pfam:F-box-like	554	593	9e-10	PFAM
low complexity region	745	759	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161078
AA Change: I228T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124524
Gene: ENSMUSG00000047013
AA Change: I228T

Domain	Start	End	E-Value	Type
ZnF_C2H2	8	33	5.81e-2	SMART
low complexity region	65	77	N/A	INTRINSIC
low complexity region	100	122	N/A	INTRINSIC
low complexity region	162	192	N/A	INTRINSIC
SCOP:d1eq1a_	197	340	2e-5	SMART
low complexity region	352	374	N/A	INTRINSIC
low complexity region	425	440	N/A	INTRINSIC
Pfam:F-box	536	592	4.8e-5	PFAM
Pfam:F-box-like	554	593	9e-10	PFAM
low complexity region	745	759	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161546
AA Change: I228T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124754
Gene: ENSMUSG00000047013
AA Change: I228T

Domain	Start	End	E-Value	Type
ZnF_C2H2	8	33	5.81e-2	SMART
low complexity region	65	77	N/A	INTRINSIC
low complexity region	100	122	N/A	INTRINSIC
low complexity region	162	192	N/A	INTRINSIC
SCOP:d1eq1a_	197	340	2e-5	SMART
low complexity region	352	374	N/A	INTRINSIC
low complexity region	425	440	N/A	INTRINSIC
low complexity region	519	540	N/A	INTRINSIC
Pfam:F-box-like	554	593	5.6e-10	PFAM
low complexity region	745	759	N/A	INTRINSIC

Meta Mutation Damage Score

0.2564

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which is characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one of the four subunits of the SCF ubiquitin protein ligase complex that plays a role in phosphorylation-dependent ubiquitination. F-box proteins are divided into three classes depending on the interaction substrate domain each contains in addition to the F-box motif: FBXW proteins contain WD-40 domains, FBXL proteins contain leucine-rich repeats, and FBXO proteins contain either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the FBXO class. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality and premature death by 10 weeks, growth retardation, abnormal gait, dragging hindlimbs, ataxia, impaired balance, impaired coordination, tremors and abnormal neuronal migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	A	G	10: 50,660,670	N700D	probably benign	Het
Babam2	G	A	5: 32,007,242	V287M	probably damaging	Het
Brip1	T	C	11: 86,189,801	I146M	possibly damaging	Het
Cacna1b	C	T	2: 24,654,430	R1248H	probably damaging	Het
Ccdc88c	G	T	12: 100,913,332	S1843R	possibly damaging	Het
Chaf1b	G	A	16: 93,901,295	A485T	probably benign	Het
Dock7	T	C	4: 98,962,224	R1594G	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Gm3739	T	A	14: 7,299,398	K86*	probably null	Het
Gm7173	A	T	X: 79,509,995	N291K	possibly damaging	Het
Mark2	A	T	19: 7,285,948	D151E	probably damaging	Het
Nop2	G	T	6: 125,133,552	R47L	probably damaging	Het
Nwd1	A	T	8: 72,670,951	D606V	probably damaging	Het
Olfr1132	T	A	2: 87,635,151	I199L	probably benign	Het
Pcbp1	T	C	6: 86,525,050	N289S	probably benign	Het
Plce1	T	C	19: 38,524,319	S21P	possibly damaging	Het
Ptpn18	T	C	1: 34,472,960	L55P	probably benign	Het
Rpl10l	T	C	12: 66,283,738	D207G	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sec23b	T	A	2: 144,578,366	I450N	possibly damaging	Het
Speg	A	G	1: 75,428,330	E2922G	probably damaging	Het
Spem1	C	A	11: 69,821,805		probably null	Het
Stxbp3-ps	A	T	19: 9,559,110		noncoding transcript	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Tmod2	T	C	9: 75,592,584	T129A	probably benign	Het
Ttc28	A	G	5: 111,280,172	T1845A	probably benign	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Ush2a	C	T	1: 188,864,625	T3854M	probably damaging	Het
Vmn2r72	T	A	7: 85,751,926	H95L	probably benign	Het
Xdh	C	A	17: 73,898,344	G1042V	probably damaging	Het
Zfp105	T	A	9: 122,930,056	V264E	possibly damaging	Het

Other mutations in Fbxo41

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Fbxo41	APN	6	85478102	splice site	probably null
IGL00919:Fbxo41	APN	6	85478570	missense	probably damaging	1.00
IGL01135:Fbxo41	APN	6	85477908	missense	probably benign	0.41
IGL02084:Fbxo41	APN	6	85480765	critical splice donor site	probably null
IGL02343:Fbxo41	APN	6	85478171	missense	possibly damaging	0.78
IGL03284:Fbxo41	APN	6	85479765	missense	probably damaging	1.00
R0116:Fbxo41	UTSW	6	85477908	missense	probably damaging	1.00
R0452:Fbxo41	UTSW	6	85478182	missense	probably damaging	1.00
R2064:Fbxo41	UTSW	6	85478471	nonsense	probably null
R2065:Fbxo41	UTSW	6	85478471	nonsense	probably null
R2067:Fbxo41	UTSW	6	85478471	nonsense	probably null
R3433:Fbxo41	UTSW	6	85477631	missense	probably damaging	1.00
R3522:Fbxo41	UTSW	6	85484181	missense	probably benign	0.00
R4086:Fbxo41	UTSW	6	85478546	missense	possibly damaging	0.93
R4520:Fbxo41	UTSW	6	85484042	missense	probably damaging	1.00
R4521:Fbxo41	UTSW	6	85484042	missense	probably damaging	1.00
R4523:Fbxo41	UTSW	6	85484042	missense	probably damaging	1.00
R4524:Fbxo41	UTSW	6	85484042	missense	probably damaging	1.00
R4867:Fbxo41	UTSW	6	85475194	missense	probably benign
R4970:Fbxo41	UTSW	6	85477924	missense	probably damaging	1.00
R5000:Fbxo41	UTSW	6	85483919	missense	probably damaging	0.98
R5112:Fbxo41	UTSW	6	85477924	missense	probably damaging	1.00
R5330:Fbxo41	UTSW	6	85479906	missense	probably benign
R5331:Fbxo41	UTSW	6	85479906	missense	probably benign
R5334:Fbxo41	UTSW	6	85478483	missense	probably damaging	1.00
R5595:Fbxo41	UTSW	6	85479901	missense	probably benign	0.00
R5632:Fbxo41	UTSW	6	85484504	missense	probably damaging	1.00
R5698:Fbxo41	UTSW	6	85477656	missense	possibly damaging	0.88
R5801:Fbxo41	UTSW	6	85484533	missense	probably damaging	0.97
R5854:Fbxo41	UTSW	6	85475094	missense	probably damaging	1.00
R6258:Fbxo41	UTSW	6	85478555	missense	probably damaging	1.00
R6260:Fbxo41	UTSW	6	85478555	missense	probably damaging	1.00
R6615:Fbxo41	UTSW	6	85478523	missense	possibly damaging	0.60
R7061:Fbxo41	UTSW	6	85475466	missense	probably benign	0.36
R7353:Fbxo41	UTSW	6	85479976	missense	possibly damaging	0.71
R7681:Fbxo41	UTSW	6	85478479	nonsense	probably null
R8077:Fbxo41	UTSW	6	85473229	missense	probably damaging	0.98
X0024:Fbxo41	UTSW	6	85478470	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGAGTGAAGCCAGCAGTTC -3'
(R):5'- AATCGAAATCCCACTCGGCG -3'

Sequencing Primer
(F):5'- GAAGCCAGCAGTTCCACGC -3'
(R):5'- AAGTCCGTGGCATCCTCTG -3'

Posted On

2015-08-18