Incidental Mutation 'R4522:Fbxo41'
ID334263
Institutional Source Beutler Lab
Gene Symbol Fbxo41
Ensembl Gene ENSMUSG00000047013
Gene NameF-box protein 41
SynonymsD6Ertd538e
MMRRC Submission 041765-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R4522 (G1)
Quality Score170
Status Not validated
Chromosome6
Chromosomal Location85469574-85502994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85484042 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 228 (I228T)
Ref Sequence ENSEMBL: ENSMUSP00000124754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159062] [ENSMUST00000161078] [ENSMUST00000161546]
Predicted Effect probably damaging
Transcript: ENSMUST00000159062
AA Change: I228T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125671
Gene: ENSMUSG00000047013
AA Change: I228T

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161078
AA Change: I228T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124524
Gene: ENSMUSG00000047013
AA Change: I228T

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161546
AA Change: I228T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124754
Gene: ENSMUSG00000047013
AA Change: I228T

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
Pfam:F-box-like 554 593 5.6e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Meta Mutation Damage Score 0.2564 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which is characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one of the four subunits of the SCF ubiquitin protein ligase complex that plays a role in phosphorylation-dependent ubiquitination. F-box proteins are divided into three classes depending on the interaction substrate domain each contains in addition to the F-box motif: FBXW proteins contain WD-40 domains, FBXL proteins contain leucine-rich repeats, and FBXO proteins contain either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the FBXO class. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality and premature death by 10 weeks, growth retardation, abnormal gait, dragging hindlimbs, ataxia, impaired balance, impaired coordination, tremors and abnormal neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Babam2 G A 5: 32,007,242 V287M probably damaging Het
Brip1 T C 11: 86,189,801 I146M possibly damaging Het
Cacna1b C T 2: 24,654,430 R1248H probably damaging Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Chaf1b G A 16: 93,901,295 A485T probably benign Het
Dock7 T C 4: 98,962,224 R1594G probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Mark2 A T 19: 7,285,948 D151E probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nwd1 A T 8: 72,670,951 D606V probably damaging Het
Olfr1132 T A 2: 87,635,151 I199L probably benign Het
Pcbp1 T C 6: 86,525,050 N289S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ptpn18 T C 1: 34,472,960 L55P probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23b T A 2: 144,578,366 I450N possibly damaging Het
Speg A G 1: 75,428,330 E2922G probably damaging Het
Spem1 C A 11: 69,821,805 probably null Het
Stxbp3-ps A T 19: 9,559,110 noncoding transcript Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmod2 T C 9: 75,592,584 T129A probably benign Het
Ttc28 A G 5: 111,280,172 T1845A probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ush2a C T 1: 188,864,625 T3854M probably damaging Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zfp105 T A 9: 122,930,056 V264E possibly damaging Het
Other mutations in Fbxo41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fbxo41 APN 6 85478102 splice site probably null
IGL00919:Fbxo41 APN 6 85478570 missense probably damaging 1.00
IGL01135:Fbxo41 APN 6 85477908 missense probably benign 0.41
IGL02084:Fbxo41 APN 6 85480765 critical splice donor site probably null
IGL02343:Fbxo41 APN 6 85478171 missense possibly damaging 0.78
IGL03284:Fbxo41 APN 6 85479765 missense probably damaging 1.00
R0116:Fbxo41 UTSW 6 85477908 missense probably damaging 1.00
R0452:Fbxo41 UTSW 6 85478182 missense probably damaging 1.00
R2064:Fbxo41 UTSW 6 85478471 nonsense probably null
R2065:Fbxo41 UTSW 6 85478471 nonsense probably null
R2067:Fbxo41 UTSW 6 85478471 nonsense probably null
R3433:Fbxo41 UTSW 6 85477631 missense probably damaging 1.00
R3522:Fbxo41 UTSW 6 85484181 missense probably benign 0.00
R4086:Fbxo41 UTSW 6 85478546 missense possibly damaging 0.93
R4520:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4521:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4523:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4524:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4867:Fbxo41 UTSW 6 85475194 missense probably benign
R4970:Fbxo41 UTSW 6 85477924 missense probably damaging 1.00
R5000:Fbxo41 UTSW 6 85483919 missense probably damaging 0.98
R5112:Fbxo41 UTSW 6 85477924 missense probably damaging 1.00
R5330:Fbxo41 UTSW 6 85479906 missense probably benign
R5331:Fbxo41 UTSW 6 85479906 missense probably benign
R5334:Fbxo41 UTSW 6 85478483 missense probably damaging 1.00
R5595:Fbxo41 UTSW 6 85479901 missense probably benign 0.00
R5632:Fbxo41 UTSW 6 85484504 missense probably damaging 1.00
R5698:Fbxo41 UTSW 6 85477656 missense possibly damaging 0.88
R5801:Fbxo41 UTSW 6 85484533 missense probably damaging 0.97
R5854:Fbxo41 UTSW 6 85475094 missense probably damaging 1.00
R6258:Fbxo41 UTSW 6 85478555 missense probably damaging 1.00
R6260:Fbxo41 UTSW 6 85478555 missense probably damaging 1.00
R6615:Fbxo41 UTSW 6 85478523 missense possibly damaging 0.60
R7061:Fbxo41 UTSW 6 85475466 missense probably benign 0.36
R7353:Fbxo41 UTSW 6 85479976 missense possibly damaging 0.71
R7681:Fbxo41 UTSW 6 85478479 nonsense probably null
R8077:Fbxo41 UTSW 6 85473229 missense probably damaging 0.98
X0024:Fbxo41 UTSW 6 85478470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGTGAAGCCAGCAGTTC -3'
(R):5'- AATCGAAATCCCACTCGGCG -3'

Sequencing Primer
(F):5'- GAAGCCAGCAGTTCCACGC -3'
(R):5'- AAGTCCGTGGCATCCTCTG -3'
Posted On2015-08-18