Incidental Mutation 'R4522:Pcbp1'
ID334264
Institutional Source Beutler Lab
Gene Symbol Pcbp1
Ensembl Gene ENSMUSG00000051695
Gene Namepoly(rC) binding protein 1
SynonymshnRNP E1, WBP17, [a]CP-1
MMRRC Submission 041765-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R4522 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location86524492-86526321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86525050 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 289 (N289S)
Ref Sequence ENSEMBL: ENSMUSP00000054863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053015]
Predicted Effect probably benign
Transcript: ENSMUST00000053015
AA Change: N289S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000054863
Gene: ENSMUSG00000051695
AA Change: N289S

DomainStartEndE-ValueType
KH 12 80 3.99e-16 SMART
KH 96 167 2.39e-14 SMART
KH 278 348 1.34e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205028
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is thought to have been generated by retrotransposition of a fully processed PCBP-2 mRNA. This gene and PCBP-2 have paralogues (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. The protein encoded by this gene appears to be multifunctional. It along with PCBP-2 and hnRNPK corresponds to the major cellular poly(rC)-binding protein. It contains three K-homologous (KH) domains which may be involved in RNA binding. This encoded protein together with PCBP-2 also functions as translational coactivators of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES and promote poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human Papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a knock-out allele exhibit reduced body weight. Mice homozygous for the allele exhibit embryonic lethality between E3.5 and E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Babam2 G A 5: 32,007,242 V287M probably damaging Het
Brip1 T C 11: 86,189,801 I146M possibly damaging Het
Cacna1b C T 2: 24,654,430 R1248H probably damaging Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Chaf1b G A 16: 93,901,295 A485T probably benign Het
Dock7 T C 4: 98,962,224 R1594G probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Mark2 A T 19: 7,285,948 D151E probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nwd1 A T 8: 72,670,951 D606V probably damaging Het
Olfr1132 T A 2: 87,635,151 I199L probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ptpn18 T C 1: 34,472,960 L55P probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23b T A 2: 144,578,366 I450N possibly damaging Het
Speg A G 1: 75,428,330 E2922G probably damaging Het
Spem1 C A 11: 69,821,805 probably null Het
Stxbp3-ps A T 19: 9,559,110 noncoding transcript Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmod2 T C 9: 75,592,584 T129A probably benign Het
Ttc28 A G 5: 111,280,172 T1845A probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ush2a C T 1: 188,864,625 T3854M probably damaging Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zfp105 T A 9: 122,930,056 V264E possibly damaging Het
Other mutations in Pcbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01417:Pcbp1 APN 6 86525854 missense probably damaging 0.96
R2968:Pcbp1 UTSW 6 86525489 missense probably damaging 1.00
R3148:Pcbp1 UTSW 6 86525489 missense probably damaging 1.00
R5119:Pcbp1 UTSW 6 86524915 missense probably damaging 1.00
R5225:Pcbp1 UTSW 6 86525227 missense probably damaging 0.96
R5386:Pcbp1 UTSW 6 86525489 missense probably damaging 1.00
R5698:Pcbp1 UTSW 6 86525152 missense possibly damaging 0.93
R7135:Pcbp1 UTSW 6 86525506 missense possibly damaging 0.80
R7329:Pcbp1 UTSW 6 86525116 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCCCTTCTCAGAGGAAAGC -3'
(R):5'- GACGCCTACTCGATTCAAGG -3'

Sequencing Primer
(F):5'- AAGCCTGGCATTGATTAGATACTGG -3'
(R):5'- AACACACCATTTCTCCGCTGG -3'
Posted On2015-08-18