Mutagenetix > Incidental Mutation

Incidental Mutation 'R4522:Vmn2r72'

334266

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r72

Ensembl Gene

ENSMUSG00000051877

Gene Name

vomeronasal 2, receptor 72

Synonyms

Vmn2r72-ps, EG244114

MMRRC Submission

041765-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.139) question?

Stock #

R4522 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85737784-85754981 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 85751926 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 95 (H95L)

Ref Sequence

ENSEMBL: ENSMUSP00000133014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063425]

AlphaFold

D3Z4N8

Predicted Effect

probably benign
Transcript: ENSMUST00000063425
AA Change: H95L

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: H95L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	82	469	2.3e-28	PFAM
Pfam:NCD3G	512	564	1.2e-18	PFAM
Pfam:7tm_3	594	832	4e-53	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	A	G	10: 50,660,670	N700D	probably benign	Het
Babam2	G	A	5: 32,007,242	V287M	probably damaging	Het
Brip1	T	C	11: 86,189,801	I146M	possibly damaging	Het
Cacna1b	C	T	2: 24,654,430	R1248H	probably damaging	Het
Ccdc88c	G	T	12: 100,913,332	S1843R	possibly damaging	Het
Chaf1b	G	A	16: 93,901,295	A485T	probably benign	Het
Dock7	T	C	4: 98,962,224	R1594G	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Fbxo41	A	G	6: 85,484,042	I228T	probably damaging	Het
Gm3739	T	A	14: 7,299,398	K86*	probably null	Het
Gm7173	A	T	X: 79,509,995	N291K	possibly damaging	Het
Mark2	A	T	19: 7,285,948	D151E	probably damaging	Het
Nop2	G	T	6: 125,133,552	R47L	probably damaging	Het
Nwd1	A	T	8: 72,670,951	D606V	probably damaging	Het
Olfr1132	T	A	2: 87,635,151	I199L	probably benign	Het
Pcbp1	T	C	6: 86,525,050	N289S	probably benign	Het
Plce1	T	C	19: 38,524,319	S21P	possibly damaging	Het
Ptpn18	T	C	1: 34,472,960	L55P	probably benign	Het
Rpl10l	T	C	12: 66,283,738	D207G	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sec23b	T	A	2: 144,578,366	I450N	possibly damaging	Het
Speg	A	G	1: 75,428,330	E2922G	probably damaging	Het
Spem1	C	A	11: 69,821,805		probably null	Het
Stxbp3-ps	A	T	19: 9,559,110		noncoding transcript	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Tmod2	T	C	9: 75,592,584	T129A	probably benign	Het
Ttc28	A	G	5: 111,280,172	T1845A	probably benign	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Ush2a	C	T	1: 188,864,625	T3854M	probably damaging	Het
Xdh	C	A	17: 73,898,344	G1042V	probably damaging	Het
Zfp105	T	A	9: 122,930,056	V264E	possibly damaging	Het

Other mutations in Vmn2r72

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00931:Vmn2r72	APN	7	85749646	missense	probably benign	0.01
IGL01019:Vmn2r72	APN	7	85738334	missense	probably benign	0.26
IGL01445:Vmn2r72	APN	7	85749646	missense	probably benign	0.06
IGL02076:Vmn2r72	APN	7	85738367	missense	probably damaging	1.00
IGL02082:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02086:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02089:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02125:Vmn2r72	APN	7	85750711	missense	probably benign	0.00
IGL02146:Vmn2r72	APN	7	85737962	missense	probably damaging	1.00
IGL02272:Vmn2r72	APN	7	85750693	missense	probably benign
IGL02514:Vmn2r72	APN	7	85738699	missense	possibly damaging	0.90
IGL02662:Vmn2r72	APN	7	85738183	missense	probably benign	0.26
IGL02697:Vmn2r72	APN	7	85738671	missense	probably benign	0.36
IGL02733:Vmn2r72	APN	7	85751813	missense	probably benign	0.05
IGL03070:Vmn2r72	APN	7	85752041	splice site	probably benign
IGL03150:Vmn2r72	APN	7	85751176	missense	probably damaging	1.00
IGL03159:Vmn2r72	APN	7	85754954	missense	probably benign	0.05
IGL03333:Vmn2r72	APN	7	85750867	missense	probably benign	0.10
R0081:Vmn2r72	UTSW	7	85751836	missense	probably benign	0.01
R0090:Vmn2r72	UTSW	7	85754876	missense	probably benign
R0655:Vmn2r72	UTSW	7	85738111	nonsense	probably null
R0778:Vmn2r72	UTSW	7	85749739	missense	probably benign	0.00
R1169:Vmn2r72	UTSW	7	85751309	missense	probably benign	0.01
R1172:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1173:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1175:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1248:Vmn2r72	UTSW	7	85749188	missense	probably benign	0.02
R1302:Vmn2r72	UTSW	7	85738257	missense	probably damaging	1.00
R1506:Vmn2r72	UTSW	7	85749211	missense	probably benign
R1632:Vmn2r72	UTSW	7	85751792	missense	probably benign	0.13
R1775:Vmn2r72	UTSW	7	85738170	missense	probably benign	0.01
R1962:Vmn2r72	UTSW	7	85749161	missense	probably benign	0.00
R2201:Vmn2r72	UTSW	7	85738236	missense	probably benign	0.12
R2290:Vmn2r72	UTSW	7	85738341	missense	probably damaging	1.00
R2327:Vmn2r72	UTSW	7	85738256	missense	probably damaging	1.00
R2424:Vmn2r72	UTSW	7	85750953	missense	probably damaging	1.00
R2655:Vmn2r72	UTSW	7	85751269	missense	possibly damaging	0.95
R2860:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R2861:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R2862:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R3009:Vmn2r72	UTSW	7	85749642	missense	probably benign	0.00
R3797:Vmn2r72	UTSW	7	85738077	missense	probably benign	0.44
R3798:Vmn2r72	UTSW	7	85738077	missense	probably benign	0.44
R3902:Vmn2r72	UTSW	7	85749735	missense	possibly damaging	0.52
R3959:Vmn2r72	UTSW	7	85751131	missense	probably benign	0.36
R3974:Vmn2r72	UTSW	7	85749809	missense	probably damaging	1.00
R4399:Vmn2r72	UTSW	7	85738500	missense	probably damaging	1.00
R4421:Vmn2r72	UTSW	7	85738500	missense	probably damaging	1.00
R4426:Vmn2r72	UTSW	7	85737828	nonsense	probably null
R4523:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4533:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4691:Vmn2r72	UTSW	7	85737911	nonsense	probably null
R4781:Vmn2r72	UTSW	7	85737861	missense	probably benign	0.14
R4863:Vmn2r72	UTSW	7	85750598	missense	possibly damaging	0.91
R4952:Vmn2r72	UTSW	7	85751109	missense	probably benign
R4991:Vmn2r72	UTSW	7	85751130	missense	probably damaging	0.99
R4995:Vmn2r72	UTSW	7	85738485	missense	probably damaging	1.00
R5095:Vmn2r72	UTSW	7	85737853	missense	probably damaging	0.98
R5174:Vmn2r72	UTSW	7	85737840	missense	probably benign	0.00
R5276:Vmn2r72	UTSW	7	85738254	missense	possibly damaging	0.90
R5395:Vmn2r72	UTSW	7	85750897	missense	possibly damaging	0.71
R5560:Vmn2r72	UTSW	7	85751942	missense	probably damaging	0.96
R5933:Vmn2r72	UTSW	7	85737850	missense	probably benign	0.05
R6033:Vmn2r72	UTSW	7	85737929	missense	probably damaging	1.00
R6033:Vmn2r72	UTSW	7	85737929	missense	probably damaging	1.00
R6354:Vmn2r72	UTSW	7	85750539	critical splice donor site	probably null
R6362:Vmn2r72	UTSW	7	85751174	missense	probably damaging	1.00
R6594:Vmn2r72	UTSW	7	85749684	missense	probably benign	0.32
R6794:Vmn2r72	UTSW	7	85737996	missense	probably damaging	1.00
R7113:Vmn2r72	UTSW	7	85749803	splice site	probably null
R7189:Vmn2r72	UTSW	7	85754917	missense	probably benign	0.36
R7266:Vmn2r72	UTSW	7	85738274	nonsense	probably null
R7323:Vmn2r72	UTSW	7	85750563	missense	probably benign
R7426:Vmn2r72	UTSW	7	85751140	missense	probably benign
R7606:Vmn2r72	UTSW	7	85751154	missense	possibly damaging	0.91
R7651:Vmn2r72	UTSW	7	85751938	missense	probably damaging	1.00
R7688:Vmn2r72	UTSW	7	85754890	missense	probably benign	0.32
R7753:Vmn2r72	UTSW	7	85750626	missense	probably damaging	1.00
R7843:Vmn2r72	UTSW	7	85749630	missense	probably benign	0.01
R8157:Vmn2r72	UTSW	7	85751233	missense	probably benign	0.09
R8254:Vmn2r72	UTSW	7	85751019	missense	probably damaging	1.00
R8389:Vmn2r72	UTSW	7	85751960	missense	probably damaging	0.99
R8444:Vmn2r72	UTSW	7	85738175	missense	probably benign
R8989:Vmn2r72	UTSW	7	85754926	missense	probably benign	0.10
R9015:Vmn2r72	UTSW	7	85749180	missense	probably benign	0.01
R9080:Vmn2r72	UTSW	7	85738256	missense	probably damaging	1.00
R9269:Vmn2r72	UTSW	7	85751203	missense	probably benign	0.03
R9317:Vmn2r72	UTSW	7	85754814	missense	probably benign	0.04
R9509:Vmn2r72	UTSW	7	85754867	missense	probably benign
Z1176:Vmn2r72	UTSW	7	85749191	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTATACATGAACATGAGTGGTCC -3'
(R):5'- CCCTTTTCTGTCAGTTAAAACCAGTAC -3'

Sequencing Primer
(F):5'- CATGAACATGAGTGGTCCTAGTC -3'
(R):5'- TGGCTCTTGCTTGTACAG -3'

Posted On

2015-08-18